SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02465
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.867
 

Sequence

CDS
ATGAGTGAGAAAGATCAAAAGGAGCTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCAGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTTAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTCGAATCGATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTGTTACAAACCGATGCGCATAGTTTTGAGAGTTGTTCTCATGTGAGTAATCATAGCCTGGTTAAATTGCCTACCATTAGTCTACCCAAATTTAATGGTTCATATAACAACTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGGAGAAATTAATAAATTCCACTACCTCAGGGCCTCGCTAGAAGGCTCTGCTGCTGTACTACTTCAGGAGATTCAGTTCTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGACAATAAGCGCCTATTAATTCAAACACATGTTAATAATTTATTTAATATAGACGCAATAAAGAATGAATCTTCGTTTAATTTAAGACGTTTCATAGATCAGCTGAATAAAAGCCTGAGAGCTTTAGAGTCGCTGGGCGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAAATCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCTCCCTAACCTTCCTCACACACAAGTTCAGCCACCACAGTCGCCTAAAGGTCAGAAAATTCAAACATTAGTTTCTGTTTCCGGAACGCAGCCGTCGTCGAGTGGCGGCGCTAGTATTTTTTCTGGTTCCGGCACAACATCGTGCCCCCACTGTAATGGTGAGCATTATCTTTATAAATGTGATAAATTTCTGAGCCTTAATAATGAGCAGAGATGGGAATTAATTCCTCAGTTCAAGGTGTGTTACAACTGCTTTCGTAGTGGTCACTATTCGAATCGCTGCAAAAAAGGTGGTTGTACTTTATGTAAGCGTAGGCATAATACGCTGCTGCACACCTATTCTAATAATAAACAGAGAATTAATCAGCCCGCTCCTAAGCGTGACACTACGGCAATCATCTCCGCCATCCAGCCTGAACCTCCTGGTAACCACGGCCTAACGTTAGCCACGTATTCTGCCGCCGCACCTTCAGAGATTAGTAAAGATGGTATGTTTGCGACGGCTCTCGTTAAAGTTGTTGATAGTAATGGTCACGAGCACATTATACGTGCTCTTCTGGATTGTGCGAGTTCGTCTTGCATCATTAGTGAGAAAACGGGTCGCTTATTGAATGCCAAGTATATTAATATAGATAAACCTATTTTCGGCATCGATAAGACTAGAACTAACACTTCAAAAATGTGTTATGTTTCTTTCAGTTCACGCACTGAAAATTATTCCAAATGTCTTCTTTGTTATGTATTGCCGTCCATAACTGACGACGTGCCTTGCCATTCATTTGATGTTTCGCATTTAAATATTCCCGCTAATATTATTTTAGCTGATCCCCAATTTTATAGGGCGTCAGAAATTGACATGATAATTGGATCTAATATCTTTTGGGATCTGCTCGGGACGCGAAAGATCAATCTGGGAGATAACATCTCTATCCTCTGGGAAACTCGACTTGGCTGGTTGGTGGTTTCAAGGGATCTAAGTGATGGTCAAGGATCTGCTCCCCTAATGTGCAACTTCACAAAACTTGCAGACATTTCTCAAGATCTTGATCTTGGCGTTGATGTAACTCAGAACTTGCTGTCGCGGTTCTGGCAGCCGAAGGAAGTCGGCCTTAAGTCATCATACTCCGAGGAGGAACGAAAATGTTTAGAACATTTCGTTAAAAATACGAAACGTCTAGCTGATGGTTGTTTTCGTGTGCGTGTACCCTTAAAACAATCTGCGGACTGCTTAAATGCGTCGCAAAGCGCCTATCGTGTTTGCCTTTACGCGCGAAGCGCGAACGTGTATAGACGAATCAAGGTCTCGTTACTTATGGCCAAGAGTAAAGTGGTTCCATTAAAGCCAACTACGATCCCTCGGTTGGAGCTCTGTGGGGCTCTGGTAGGAGTGCGCCTCTACGAGAAGGCTATTGATTCGCTCCGGGTTCAGATTTCGGGATTTCGTGGAATTGAAATTGAATTGAGAAATGAAATACCTCCAACTTCTAATCCTAAATCATTTATTGGATGTACTTAG
Protein
MSEKDQKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKLLQTDAHSFESCSHVSNHSLVKLPTISLPKFNGSYNNWLEFHDTFSSLIHSNEAIGEINKFHYLRASLEGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNIDAIKNESSFNLRRFIDQLNKSLRALESLGEPTDHWDTLLIHMMSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTLPNLPHTQVQPPQSPKGQKIQTLVSVSGTQPSSSGGASIFSGSGTTSCPHCNGEHYLYKCDKFLSLNNEQRWELIPQFKVCYNCFRSGHYSNRCKKGGCTLCKRRHNTLLHTYSNNKQRINQPAPKRDTTAIISAIQPEPPGNHGLTLATYSAAAPSEISKDGMFATALVKVVDSNGHEHIIRALLDCASSSCIISEKTGRLLNAKYINIDKPIFGIDKTRTNTSKMCYVSFSSRTENYSKCLLCYVLPSITDDVPCHSFDVSHLNIPANIILADPQFYRASEIDMIIGSNIFWDLLGTRKINLGDNISILWETRLGWLVVSRDLSDGQGSAPLMCNFTKLADISQDLDLGVDVTQNLLSRFWQPKEVGLKSSYSEEERKCLEHFVKNTKRLADGCFRVRVPLKQSADCLNASQSAYRVCLYARSANVYRRIKVSLLMAKSKVVPLKPTTIPRLELCGALVGVRLYEKAIDSLRVQISGFRGIEIELRNEIPPTSNPKSFIGCT

Summary

EMBL
NWSH01001945    PCG69607.1    NWSH01001014    PCG73111.1    KQ459312    KPJ01687.1    + More
KQ460211    KPJ16510.1    KQ460205    KPJ16960.1    NWSH01001201    PCG72150.1    GAIX01014054    JAA78506.1    KQ460500    KPJ14270.1    KQ977963    KYM98425.1    GALX01005110    JAB63356.1    GEZM01012999    JAV92824.1    KQ460970    KPJ10166.1    GEZM01086715    JAV59020.1    KQ458793    KPJ04955.1    KQ979276    KYN22031.1    KQ460545    KPJ14069.1    KQ977557    KYN02007.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    KQ981002    KYN10407.1    KQ981127    KYN09299.1    KQ978855    KYN27942.1    KQ979016    KYN24380.1    KQ977342    KYN03430.1    GGMR01014413    MBY27032.1    GGMS01001896    MBY71099.1    GEZM01055231    JAV73081.1    KQ973442    KXZ75531.1    KQ977691    KYN00577.1    KQ977081    KYN05932.1    GGMS01000724    MBY69927.1    GEHC01000870    JAV46775.1    GBBI01004140    JAC14572.1    GGMR01020322    MBY32941.1    QOIP01000005    RLU22365.1    GGMR01018506    MBY31125.1    GBBI01004139    JAC14573.1    GFTR01008874    JAW07552.1    GBGD01000063    JAC88826.1    GGMR01017803    MBY30422.1    GGMR01011015    MBY23634.1    GGMR01013586    MBY26205.1    ABLF02042806    ABLF02006001    ABLF02006002    ABLF02023723    ABLF02041599    ABLF02016109    ABLF02016113    KQ414692    KOC63601.1    ABLF02004142    ABLF02021176    ABLF02066403    ABLF02055387    ABLF02016099    GGMS01010815    MBY80018.1    ABLF02011452    GGMR01015704    MBY28323.1    LKEX01009637    KYN50127.1    GEHC01000939    JAV46706.1    KQ977311    KYN03597.1    GEHC01000864    JAV46781.1    GGMR01020500    MBY33119.1    GEHC01000869    JAV46776.1    ABLF02007122    ABLF02033517    LKEX01024252    KYN50342.1    LBMM01008722    KMQ88672.1    GGMR01005292    MBY17911.1    ABLF02018588    ABLF02018590    ABLF02042430    ABLF02031260    ABLF02041727    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    KQ977737    KYN00241.1    GGMS01016389    MBY85592.1    ABLF02006985    GGMR01000832    MBY13451.1    LBMM01008464    KMQ88855.1    GEHC01000946    JAV46699.1    GBBI01004032    JAC14680.1    ABLF02041590    ABLF02012925    ABLF02012929    ABLF02012930    ABLF02041519   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF07679   I-set
PF02945   Endonuclease_7
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF48726   SSF48726       

Ontologies

Topology

Length:
808
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00188
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1  -  808
 
 

Population Genetic Test Statistics

Pi
234.78181
Theta
197.328946
Tajima's D
0.398593
CLR
0.000277
CSRT
0.489175541222939
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号