SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02448
Annotation
retrovirus-related_gag-pol_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 4.046
 

Sequence

CDS
ATGACTTCTAATATTAATATTGATCGACTTACGGGTGATAACTATGACACCTGGAAGATTCACATGCGAGCTATTCTGAAGAAGAATGATTTGTGGGAATACGTATCAGGAAAAATACCGAAACCAATACATTCAGATTCTAAATATTCTGAATGGAATAAAATGGACGGAAAAGCCGAATCGGACATATTGTTAGCTGTCAGCCCGAGCGAGTTAATTGCACTGGATGGTTTAGACTCCTCTAAAGCAATATGGGACAAGTTAAAATCTATGTATGAGTCAAGCGGGCCAGCGCGAAAAGCGTCATTACTAAAGAGACTTGTATTAAATCATATGCCAGAAGATGGAGACCTACGAAAACATATTTCTGATTTTTTCGACTGTGTTAAGAAGCTTAAAGAAATCGGATTGATAGTGATAGATGAGTTGCTTGCTATTTTATTACTTTATAGTTTACCGGATTCGTTCTCAATGTTTCGAACAGCAATGGAATCGCGTGATGATTTACCATCAACTGATGTACTGAAAGTGAAGATTATCGAGGATTATGAAGGTCGGAAGAGTAAGATAATAGACCAGAGGGCTATGTTCGTCAAGCGTACCAATATTAAATCAAATGCCAACCCGAAGAAGAACTTTGAACAGCACACAAATAAAAACATTGAGTGCTATCGTTGCGGTCGTCTTGGGCATATGGCGAGAGAGTGCAGAACTAAAAACGTGAGTAAGCTTAAACAAAGCTCACATAAAGCAGAATGTAATAGTGATGATGAGCACAAGACAACTATGTTAGTAAGTACCACCAAAGAGGTGATGATAGCCGAGCAGAGAGCTCCTGTATGGTGTATTGACAGTGGATGTACGGGACATATGTGTAACAACAAACAATTGATTAAAGATTTTACTCGAGTTGATACAGACTTGAATTTGGCTAATGGTAAAACTACAAAAATTAGCGGTTCGGGAAAAGTCAGTACTATGGTAGACACAGGCAGCGAAAAGCGCCATGTTGATATTAAAAAAGTGTTCTACGTGTCGGATCTACGAACTAATTTATTATCAGTTGCGAAGATGACAGATCACGGGTTTGAAGTTCGCTTCAATAAAAATTATGCAATTGTCATAGATGACAATAATAAGGTTCATATGCGAGCGGATCGAGTTGGTAACTTATACCACGTCCGAATGAGCCAAGATGATGTCAATAATGTTGAAATGGTGAAAAAACCTATAGATATGTGGCACGAGCGCCTCGGCCATCTTAACGAGCGTGATTTAAAGGCAATGGCGAAAAATGGCCTTGTCCATGGCCTATCATTGAAGGACAACGAAAAATTGTCAGAGTGTGAAATATGTATAAGTGAAAAACAGACATGCACGCCTTTTTCTAAAGGAAGCGAAGATCGTACCAGTGAACTATTGGAGATCGTGCATACAGATGTGTGCGGACCAATGAGACAACAGTCTATGGGCGGTAAAAAGTATTTTGTCACATTCATCGACGACAAATCAAGATGGTGTGAAGTATACTTTATTGCTAATAAAAGCGACGTACTTCAAGTTTTCAAAGATTACAAGGCTTACGTGGAAAAATTGACAGGAAAGAAGATCAAAAATCTACAATCCGATAACGGTCGAGAATACATTAACAAAGACTTTGATGATTTCTTGAAGAAAGAAGGAATAAGACGGAGGTTGACGGCACCTTATACGCCTCAGCAGAACGGGATTTCGGAGAGAAAGAACAGGACATTGCTAGAGATGGCCCGTTGTATGATGCGTCAGGCGGGAAGCCCTCCTGTTTTTTGGGCTGAAGCAATTAATACTGCTAATTACATAAGGAACCGATGCCCCACTGCAGCTCTTGATGGTCAAATACCATTTACCCTGTGGAAAGGAAAGAAACCTACCGTAATCTACATGCGCGTGTTTGGATCGAAAGCGTATTATAAAAACAAAGGAACGCAGAAGGGAAAATTCGAATCAAGTTCAGAGCTTGGAATATTTATGGGCTATGCTACTGAGTCTAAAGCTTACAGAATACATGATCCTAAGACTAGAAGAATCGTCATTTCTCGCGATGTGAAGTTTATGAACGAGACAGCATTCTGTCATGAGTATAAAGAAATACGAAATGACGAAGAAGAGAGTTTTGATAATTCGAAGATAGTCGTTGAATTGACAGGACATGATCAGAAGAAGGAAGATCGAAAAACAAACCCCATGAGAGGGAGAGGAAGACCAAGGATAGTTCGTACTGGCTTAGTGGGAAGACCGCGCAAAGAGTATAAACCAGCTACTAACAGTACAGAGAGTGAAACTGAATCGGAGTATGAAGTAGATAATGAAGAAACGATAGCTGGAATTGCGATTATGGAACCTAAAACATGGAAAGAAATAGAAAAGACTGATGACGAACCTGAATGGCGAAGGGCTTTAGAAGACGAGTATTTGGCACAATTAAAGAATGTTACATGGGAAATAGTCCCACGACCGAAAAATAGAAAAGTGATTGGTAGCAGATTTGTATTTCAAACAAAGAATACAGGGAAGAAAGTACGGCTTGTCGCAAAGGGATGTTCTCAAAGGCCAGGGGAGGATTTTTACGAAACCTTTTCTCCTGTTGTAAGGTCTTCATCTGTGAGACTCATAGCTGCAGTGTCAGCAGAGTTAGGATTAGAGATGCATCAAATGGATGTAGTAACAGCTTACTTGAATGGTACTCTCGAAGAAGATGTATTCATGGAAATACCAGATAAACTATCAGATGTCTTAGAAAGTGTACTAGCAAACCAAAATATTGGATCAAAACGAGATATTATAAGAGATAAGAATATACTTCATACAGCTAAACGCTGGAACGAAGCATTGAATGAGTGTGAGAATAATGTGTGTTTGTTAAAGAACTCTTTGTATGGTTTGCGTCAATCAGGATTACAGTGGCATAAAAAGTTAGTAGGAAGGTTGAAGAATATTGGTTTTGAAGCATTACCACAAGAACCTTGTGTGTTTGTTGCGCAAAGGGATGAAAAAATGATGTTAATTGCTATTTATGTAGATGACATTATCCTAGCTACTAATGATGAGGTGTGGTTGCATGATGTTAAGCGTCAGTTATCTAATGCCTTTGAAATGAAGGATATGGGAAAAATCAGTACTTGTTTGGGTATCGAATTTTCACGTGATAAGGAGCATAGAGTGTATTTAAAGCAAGGTGCGTATATAGATAAAGTATTAGAGCGTTATGGTATGAGTGATTGTAAACCTATATCAACACCTATGGATGTGAACGTTAAACTAGAAAAACCCAACAGTGTAAACAATGATGTTATGAGTCAGTACCCTTACCAGAACCTTATAGGTGCCCTTATGTATTTGGCTGTATCTACCAGACCGGATATAGCTTATACTGTAAATTATTTAAGCCAATTTAACACTAATTATGATGTACAGCATTGGAAGGCAGCTAAGCGAGTGTTGAGGTATTTGAAAGGTACATCAACTTTCGGCTTAATGTATGAGAGGACAGGTGTACCATTGTTTGGTGTAGTTGATGCAGACTGGGGTGCAAATACGATTGATAGAAGGTCATATTCCGGTTTTGCATTTATTTTAGCAGGTGCCCCAATTACCTGGGAAGCACGAAAACAGCGTACCGTTGCATTATCGAGCACAGAAGCCGAGTACTTGGCGCTTTCTGAAGCAACTAAGGAAGCTATGTATCTCAGAAATGTGATAAACAATGTTGGTGTAAAATGTAGTTGTGTGACATTATTTAATGACAACCAGGGTGCTATGAAGCTTGCACAGAGTAGAAGCTATCATTCTCGCACTAAGCATATTGATGTTAGACACCATTTTGTTCAAGATATGTGTGAACAGAGTGTGATTGATTTGAAATACTTGAGTACAGACAAAATGCCTGCTGATATTTTGACCAAGGGCTTGTGTGGGACGAAGCATTATGAATGCATGAATAATTTAGGTATGATGGAATAA
Protein
MTSNINIDRLTGDNYDTWKIHMRAILKKNDLWEYVSGKIPKPIHSDSKYSEWNKMDGKAESDILLAVSPSELIALDGLDSSKAIWDKLKSMYESSGPARKASLLKRLVLNHMPEDGDLRKHISDFFDCVKKLKEIGLIVIDELLAILLLYSLPDSFSMFRTAMESRDDLPSTDVLKVKIIEDYEGRKSKIIDQRAMFVKRTNIKSNANPKKNFEQHTNKNIECYRCGRLGHMARECRTKNVSKLKQSSHKAECNSDDEHKTTMLVSTTKEVMIAEQRAPVWCIDSGCTGHMCNNKQLIKDFTRVDTDLNLANGKTTKISGSGKVSTMVDTGSEKRHVDIKKVFYVSDLRTNLLSVAKMTDHGFEVRFNKNYAIVIDDNNKVHMRADRVGNLYHVRMSQDDVNNVEMVKKPIDMWHERLGHLNERDLKAMAKNGLVHGLSLKDNEKLSECEICISEKQTCTPFSKGSEDRTSELLEIVHTDVCGPMRQQSMGGKKYFVTFIDDKSRWCEVYFIANKSDVLQVFKDYKAYVEKLTGKKIKNLQSDNGREYINKDFDDFLKKEGIRRRLTAPYTPQQNGISERKNRTLLEMARCMMRQAGSPPVFWAEAINTANYIRNRCPTAALDGQIPFTLWKGKKPTVIYMRVFGSKAYYKNKGTQKGKFESSSELGIFMGYATESKAYRIHDPKTRRIVISRDVKFMNETAFCHEYKEIRNDEEESFDNSKIVVELTGHDQKKEDRKTNPMRGRGRPRIVRTGLVGRPRKEYKPATNSTESETESEYEVDNEETIAGIAIMEPKTWKEIEKTDDEPEWRRALEDEYLAQLKNVTWEIVPRPKNRKVIGSRFVFQTKNTGKKVRLVAKGCSQRPGEDFYETFSPVVRSSSVRLIAAVSAELGLEMHQMDVVTAYLNGTLEEDVFMEIPDKLSDVLESVLANQNIGSKRDIIRDKNILHTAKRWNEALNECENNVCLLKNSLYGLRQSGLQWHKKLVGRLKNIGFEALPQEPCVFVAQRDEKMMLIAIYVDDIILATNDEVWLHDVKRQLSNAFEMKDMGKISTCLGIEFSRDKEHRVYLKQGAYIDKVLERYGMSDCKPISTPMDVNVKLEKPNSVNNDVMSQYPYQNLIGALMYLAVSTRPDIAYTVNYLSQFNTNYDVQHWKAAKRVLRYLKGTSTFGLMYERTGVPLFGVVDADWGANTIDRRSYSGFAFILAGAPITWEARKQRTVALSSTEAEYLALSEATKEAMYLRNVINNVGVKCSCVTLFNDNQGAMKLAQSRSYHSRTKHIDVRHHFVQDMCEQSVIDLKYLSTDKMPADILTKGLCGTKHYECMNNLGMME

Summary

EMBL
GAMC01007164    JAB99391.1    GAMC01002869    JAC03687.1    LBMM01008999    LBMM01007721    + More
KMQ88472.1    KMQ89488.1    JYDP01000350    KRZ01021.1    GFTR01008771    JAW07655.1    JYDN01000113    KRX56900.1    JYDM01000185    KRZ84108.1    LBMM01012368    KMQ86259.1    JYDJ01000518    KRX34768.1    LBMM01007580    KMQ89607.1    LBMM01008805    KMQ88628.1    LBMM01008884    KMQ88558.1    GAKP01000358    JAC58594.1    JYDH01000361    KRY26687.1    GAMC01013937    JAB92618.1    GAMC01015163    JAB91392.1    GBGD01000131    JAC88758.1    FJ238509    ACI62137.1    GBXI01002679    JAD11613.1    GAMC01008929    JAB97626.1    LBMM01010043    KMQ87706.1    GDHF01006360    JAI45954.1    GBXI01007143    JAD07149.1    GAMC01020352    JAB86203.1    GAMC01008189    JAB98366.1    LVZM01013697    OUC43997.1    GDHF01000873    JAI51441.1    GDHF01029905    JAI22409.1    GDHF01030254    JAI22060.1    GAMC01018338    JAB88217.1    GAMC01020355    JAB86200.1    GBXI01017107    JAC97184.1    KQ460297    KPJ16236.1    JYDK01000327    KRX69779.1    GAMC01019998    JAB86557.1    KQ459875    KPJ19636.1    FJ544853    ACL97384.1    FJ544851    ACL97383.1    FJ544856    ACL97386.1    LBMM01012669    KMQ86061.1    FJ544854    ACL97385.1    GDHC01011760    JAQ06869.1    JXUM01155348    KQ572178    KXJ68066.1    OIVN01001052    SPC89229.1    JYDL01000068    KRX18751.1    OIVN01000557    SPC82046.1    OIVN01002854    SPD06945.1    AC134048    DP000010    AAX92941.1    ABA91548.1    GAMC01011082    JAB95473.1    OIVN01005591    SPD23209.1    OIVN01001534    SPC95017.1    CM007892    OTG31811.1    X07656    CAA30503.1    KA648745    AFP63374.1    OIVN01000269    SPC77391.1    OIVN01001666    SPC96375.1    OIVN01004379    SPD17029.1    LBMM01012645    KMQ86082.1    OIVN01000036    SPC73022.1    OIVN01004879    SPD19723.1    LSMT01001145    PFX12880.1    AM433482    CAN69340.1    OIVN01005024    SPD20514.1    LBMM01004924    KMQ91985.1    AAZX01023229    JYDS01000421    KRZ07267.1    OIVN01001931    SPC99063.1    ABLF02041793    JXUM01136904    KQ568499    KXJ68982.1    AC129717    AAT85194.1    AM447500    CAN74198.1    OIVN01002247    SPD01987.1    CM003610    KYP61490.1    CM007893    OTG30017.1    OIVN01002904    SPD07378.1    KQ485623    KYP31853.1    AM461850    CAN61435.1    OIVN01000189    SPC75922.1    AM486774    CAN71029.1    OIVN01000404    SPC79669.1    OIVN01006466    SPD33659.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    CM003605    KYP71150.1    AM458081    CAN67882.1    AM443615    CAN76321.1    AM489192    CAN71109.1    AC006248    AAD17409.1    CM003603    KYP77007.1    OIVN01000319    SPC78222.1    OIVN01001130    SPC90232.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF14244   Retrotran_gag_3
PF13961   DUF4219
PF00098   zf-CCHC
PF03159   XRN_N
PF17846   XRN_M
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR036397   RNaseH_sf        + More
IPR025724   GAG-pre-integrase_dom       
IPR013103   RVT_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR029472   Copia-like_N       
IPR036875   Znf_CCHC_sf       
IPR025314   DUF4219       
IPR004859   Put_53exo       
IPR041412   Xrn1_helical       
IPR027073   5_3_exoribonuclease       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
IPR036047   F-box-like_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
SSF81383   SSF81383       
Gene 3D
PDB
4PA1     E-value=0.0107644,     Score=96

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1332
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.45651
Exp number, first 60 AAs:
0
Total prob of N-in:
0.17424
outside
1  -  1332
 
 

Population Genetic Test Statistics

Pi
51.290194
Theta
24.705423
Tajima's D
-1.668543
CLR
191.384953
CSRT
0.0407979601019949
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号