SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02436
Annotation
Uncharacterized_protein_OBRU01_07814_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 4.356
 

Sequence

CDS
ATGGATAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAACTACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTACTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACATAAATAACAGACTTAAATACTTGAAACAGCAAAAACAGAGTGTGAATTTTGATTTAAGTGACATTTCTGTTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAGAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTATCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCAAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGCATGTACTCAGATATAGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGAAACTACAGTAAGTGGATCTCTTTTAAGGACCTGTTTCTCGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCCGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGCCGCCTACAATTTTCATCGTTTTTCAACACAATGATGAGTCTCCCTATTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGGCTGGATACGGCAACGTGGGATCCAATGATCGTGCATTTAATGTTGCCGAAATTAGATTCAACAACTTTAAATGATTATATGAACGAAATCCGAGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTTAAAAATACCACTTCCGAAAAAACATCTCATTGGAAACCGGCTAAAAAAATTTACATATGA
Protein
MDKLELQSTCFENIKTLCTNYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDINNRLKYLKQQKQSVNFDLSDISVDYTQDCEDGKSEKIQQLLNKQECNFNAIYHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDIEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPIIHQPDANNLKKMHDVIKECMNGIANIGLDTATWDPMIVHLMLPKLDSTTLNDYMNEIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEKTSHWKPAKKIYI

Summary

Pfam
PF03564   DUF1759        + More
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00230   MIP
PF12259   Baculo_F
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF00078   RVT_1
Interpro
IPR005312   DUF1759        + More
IPR029060   PIN-like_dom_sf       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR000425   MIP       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR023271   Aquaporin-like       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR022048   Envelope_fusion-like       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
SUPFAM
SSF88723   SSF88723        + More
SSF53098   SSF53098       
SSF81338   SSF81338       
Gene 3D

Ontologies

Topology

Length:
420
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00725
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00881
outside
1  -  420
 
 

Population Genetic Test Statistics

Pi
58.234721
Theta
78.034597
Tajima's D
-0.808426
CLR
666.032924
CSRT
0.178141092945353
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号