SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02405
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.404
 

Sequence

CDS
ATGGAACACGCCCGACCACCGTCAGAATTGAGTCTGGAAGGCAACTCCGTCAGCCGGGCTGACGCATGGAAGCGTTGGAGGAAACAATTTCATGTATTTTTGAAAGCATCAGGGGTGCATAAAGAAGAAGGCAGTGTGCAAGCCAGCTTGCTCATCAATTTAATTGGAACGGAAGGTTTCGATGTGTACGAGACGTTTAAGTTTTCAAATGACACTGAAAAAGATGACGTAACGGTTTTGTTAAAAAAATTCGACGAATACTTCGGCGTCAAACCAAATGTTACGTTGGCGAGATATAATTTCTACATGAGAAACCAGGAAGGCGGCGAGTCCATAGATCAGTATGTGACGGCTTTGAAACTGCTGAGCAAAACCTGTGAATTTAAAACCTTAGAAGACGAATTCATTCGCGATCGGATCGTATGTGGCCTAAAAAATACGATAGTTCGCGATCGTTTACTGAGAACGGACGACCTGACGATGGACAAAGCTATTAAAATATGCCAAGTCGACGAGGTATCGGCGGACAGCAGTCGCGTATTGCAGGAGTCGCGCGGAGCGAGCGCGGAGCCGGTGCGCGTGGACGCTGTGGGCGCGCGGGGTGGTGCTGGGCCACGTGCGGCGCGGGGCCGAGCCGGCGGCGCGCGAGCAGCTCGCGGCGGCCGCGGCGGTCACCGGCTGCGTGCGGTCCCGGATGGCGCGGGGCGCCCGCCGCCTCTTTCCAGTTCATCTGCGTCCAGTACTTGTCTCAGGTGCGGAGGTCCGTGTGTTAGTTGGGCTCACTGTCCTGCGGTCTCAGTGCAGTGTTATGTGTGTCAAAATTATGGTCATTTTGCAAGAATGTGTCAAGTACATAAAGGTGTAAAAAAGTTATATGATATCGGTGTTCTAGAGGACGAAAATAAATACGAGCCGGAACTGGACGATGACTGGGAGTCGTTTTATATATCTACTTTAATTGATGGTTCCAAAATCGACTCGTTGTCGCAGGATTGGTTTGAGGTCCTCCGAGGAGAATGGGGCTCGGAAAATTTTAAACTAGACTCGGGTGCAGATATCAATGTCTTATCTTTTAAGCGATTTGTGCAGTTAGGCAATAACCCTAATAACATTGTTGTAAATCATAAGGTTAAACTGCAATCTTACAGTGGCGATTTCATTCCTATTAAGGGAATTTGTAATATTAAATGGTGGTATAAAAATGTTCAATATGATCTTAAGTTTGCGATAGCTGATATTGATTGTCAAAGTGTACTGGGACTGCAGGCGTGCTTATTATTAGGGTTAATAAAAAGAATTCACGATATAAATTTCTCTAAAAATAGTGATTTGTTCACTGGGTTAGGTTGTTTACCGGGGGAATATCATATAACGGTAGATAGGGATGTGACGCCGGTGGTGTGCGCTCCGCGGAAAGTACCGTTAAGCCTTCGTGATAACTTGAAGGACGAACTCGATAGGATGACAGAGTTAGGTGTGATTAGGAAGGTGACTCATCCGACACCTTGGGTCAACTCGTTAGTAGTAGTGGCCAAGACAAATGGTAAAATGCGCATATGCCTAGACCCGAGACCTCTCAATAAGGCGATTCAACGTGCTCATTTTCAACTACCCACCATAAATGAGTTGGCTACCAAATTGAATGGGGCTAAATATTTTTCGGTATTGGACGCCAATTCAGGATTTTGGTCCGTAAAGCTAGATAAGGAGAGTGCCGATTTATGCACATTTATTACGCCGTTTGGGCGATATCAATATCTAAGATTACCGTTCGGACTGAACTGCGCACCGGAGGTATTCCACGCTAAATTAAAACAATTGTTAGAAGGTTTAGACGGTGTTGAGTCGTTTATTGATGATATTATTGTCTGGGGGTCCACTAGGCGAGAACATGATGTAAGACTAAATGCGTTATTTCAAAAAGCGCGAGATATTAATTTAAAGTTTAACAAAGATAAGTGTCGCATTTGTGTCGATGAGGTGACATATTTGGGACATATTTTTAATAAAGACGGAATGAAAGTAGATACGGAAAAAGTGCGGGCTGTAATCAATATGCCGGAACCTACGGATTGTAAAAGTTTAGAAAGGTTCTTGGGTGCAATTAATTATTTATCAAAGTTTATACCTAACTACTCGCAACACATATTTCCATTGACTAGATTATTGAAAAAAGATGTCGAGTGGTGTTGGGAAATAGGTCACAAAAACGCCTTTGATAAATTAAAGAAACTGATATGCGAGGCTCCGGTATTATCGTTGTTTGACGTAGGCAGTGAGGTATTGTTGTCGGTGGACGCGAGCAGCGTCGCACTTGGCGCGGTGCTGATGCAGCGCGGCCGCCCGGTCGAGTACGCGTCGCGCACACTCACCGACACACAACAGAGATACGCTCAGATTGAAAAAGAAATGTTAGCTATTGTCTTTGCTTGTGAAAAATTTCACCAGTACATTTATGGAAAAAGGTATATAGTCATAGAAACTGACCATAAACCTCTTGAAAGTATTTTTAAAAAGCCGCTCAATTCAGTCCCAGCACGCTTGCAGCGTATGATGTTAAAATTACAAGGGTACGATCTGAAAATTACTTATAAACCGGGGAAGTATATGTATATACCCGACACGTTATCACGTGCGCCTCTTCCGGATTTATATGACGATAAAATTAGTAAGGCAGTATTGAACCAATTAAAAATGGTAATTAACAATGTACCGATGTCTCAAAGCAAACTGACATTAGTTAAGAAAGAAACTAGTAAAGATGAGTATTTGAAACGTTTGTTAGTTTACATTAATGAAGGTTGGCCCGTTCATAAATATAATGTTGATAGTGATTTAAAGTATTTTTGGTCCATGAGAGACGAGCTGTACTCTGTTGACGGAGTAATTTTTAAAGATAAACAGCAACAGCATAAAACAATAATAGAAAAACAATTAAAAAGTAAAATGTATTATGACCAACATTGTAAAGAGCAGCCGGAGCTAAGTGTCGGCGATGATGTAATTATGTTAGAACATAATAATGAACGAATGCGCGGCACTGTCGTAGGCAAGGCATCTGCACCGCGTTCATACATTGTAAAAAACAAATTAGGTATATATCGACGTAATCGCCGACATTTAATTAAAAATATGCCTGATGAGAAACCTAATGTTGTGGAAAAGCTGAAGAATGATCGGCGCGGCACAATAGTGATCGTATCAGACGAGTCAAGTGGGGGAGAATATGAGATGAGTGTGGATGAGGATGGTTCAGTGTACGAACCGAGTACTTTGTCATCACCTTCATCACCTCATATTTATCCGCCTACTACTCGTAGTAGAACTAAGCAGAATGCAATTAATAATAATTAA
Protein
MEHARPPSELSLEGNSVSRADAWKRWRKQFHVFLKASGVHKEEGSVQASLLINLIGTEGFDVYETFKFSNDTEKDDVTVLLKKFDEYFGVKPNVTLARYNFYMRNQEGGESIDQYVTALKLLSKTCEFKTLEDEFIRDRIVCGLKNTIVRDRLLRTDDLTMDKAIKICQVDEVSADSSRVLQESRGASAEPVRVDAVGARGGAGPRAARGRAGGARAARGGRGGHRLRAVPDGAGRPPPLSSSSASSTCLRCGGPCVSWAHCPAVSVQCYVCQNYGHFARMCQVHKGVKKLYDIGVLEDENKYEPELDDDWESFYISTLIDGSKIDSLSQDWFEVLRGEWGSENFKLDSGADINVLSFKRFVQLGNNPNNIVVNHKVKLQSYSGDFIPIKGICNIKWWYKNVQYDLKFAIADIDCQSVLGLQACLLLGLIKRIHDINFSKNSDLFTGLGCLPGEYHITVDRDVTPVVCAPRKVPLSLRDNLKDELDRMTELGVIRKVTHPTPWVNSLVVVAKTNGKMRICLDPRPLNKAIQRAHFQLPTINELATKLNGAKYFSVLDANSGFWSVKLDKESADLCTFITPFGRYQYLRLPFGLNCAPEVFHAKLKQLLEGLDGVESFIDDIIVWGSTRREHDVRLNALFQKARDINLKFNKDKCRICVDEVTYLGHIFNKDGMKVDTEKVRAVINMPEPTDCKSLERFLGAINYLSKFIPNYSQHIFPLTRLLKKDVEWCWEIGHKNAFDKLKKLICEAPVLSLFDVGSEVLLSVDASSVALGAVLMQRGRPVEYASRTLTDTQQRYAQIEKEMLAIVFACEKFHQYIYGKRYIVIETDHKPLESIFKKPLNSVPARLQRMMLKLQGYDLKITYKPGKYMYIPDTLSRAPLPDLYDDKISKAVLNQLKMVINNVPMSQSKLTLVKKETSKDEYLKRLLVYINEGWPVHKYNVDSDLKYFWSMRDELYSVDGVIFKDKQQQHKTIIEKQLKSKMYYDQHCKEQPELSVGDDVIMLEHNNERMRGTVVGKASAPRSYIVKNKLGIYRRNRRHLIKNMPDEKPNVVEKLKNDRRGTIVIVSDESSGGEYEMSVDEDGSVYEPSTLSSPSSPHIYPPTTRSRTKQNAINNN

Summary

EMBL
MRZV01000618    PIK46835.1    MRZV01000576    PIK47528.1    GGMR01000868    MBY13487.1    + More
MRZV01000033    PIK61397.1    GBBI01004745    JAC13967.1    HADY01023773    HAEJ01006887    SBS47344.1    ABLF02013930    ABLF02013934    GBHO01004090    JAG39514.1    GEZM01016880    JAV91071.1    GDHC01013957    JAQ04672.1    GEZM01066276    JAV68015.1    GBGD01000115    JAC88774.1    GBGD01000119    JAC88770.1    HADZ01002490    HAEA01007842    SBQ36322.1    HAEH01020882    SBS11479.1    HAEF01001580    SBR38962.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    GCES01096219    JAQ90103.1    GDIP01019161    JAM84554.1    GDIP01203362    JAJ20040.1    GDIP01199810    GDIP01181260    GDIP01124130    GDIP01104931    GDIP01053137    GDIP01051184    JAL98783.1    GEGO01004116    JAR91288.1    GDIP01239061    JAI84340.1    GDIP01073678    JAM30037.1    GDIP01102077    JAM01638.1    GDIP01156216    JAJ67186.1    GEZM01035137    JAV83383.1    NIVC01000291    PAA86189.1    AERX01070080    GCES01104253    JAQ82069.1    HAEH01000697    SBR65395.1    GEGO01004841    JAR90563.1    NIVC01000102    PAA90881.1    GEZM01041944    JAV80090.1    NIVC01004589    PAA47069.1    GEZM01074317    JAV64601.1    GEGO01004317    JAR91087.1    GEGO01003204    JAR92200.1    AAGJ04126635    GEZM01011167    JAV93617.1    GBHO01042421    GBHO01026477    JAG01183.1    JAG17127.1    KF319019    AIE48224.1    GDHC01017753    JAQ00876.1    AAGJ04066141    AAGJ04164197    GEZM01051395    JAV74977.1    GGMR01004179    MBY16798.1    ABLF02041541    GBHO01044535    JAF99068.1    GEZM01102055    GEZM01102054    GEZM01102053    GEZM01102051    JAV52011.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF03732   Retrotrans_gag
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR005162   Retrotrans_gag_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=5.51694e-53,     Score=529

Ontologies

Topology

Length:
1117
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00111
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.00002
outside
1  -  1117
 
 

Population Genetic Test Statistics

Pi
1.770224
Theta
10.87095
Tajima's D
-1.732444
CLR
142.343148
CSRT
0.031948402579871
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号