SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02397
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.321
 

Sequence

CDS
ATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACAGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTTCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCACCGGTCGCCGCCGACCCATTTAGCTTTATTCGCTGACGATACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAACCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGTGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCTTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGACGCTCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGTTCGCCGTGCAACCTAA
Protein
MANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNSLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIHRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALTLGQWFRKWRIDINPVKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRSRHVLTDPSDPITFALDAFSSNTRSRLRDLGNRTRRTRQRVRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459580    KPI99178.1    AF081101    AAC72919.1    GGMR01019198    MBY31817.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    ABLF02008933    GALX01005300    JAB63166.1    GGMS01004685    MBY73888.1    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    ABLF02042518    ABLF02057746    KK117880    KFM71667.1    KK113014    KFM59099.1    ABLF02066620    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KL813758    KFM83187.1    GGMS01017914    MBY87117.1    GGMS01000737    MBY69940.1    ABLF02008463    GGMR01016114    MBY28733.1    ABLF02033757    GEZM01038405    JAV81653.1    ABLF02008153    ABLF02008462    ABLF02008464    AF012049    AAC24972.1    GGMS01008766    MBY77969.1    GBBI01004571    JAC14141.1    GFTR01008038    JAW08388.1    KK115908    KFM66338.1    GGMR01003407    MBY16026.1    GGMR01004661    MBY17280.1    ABLF02019349    ABLF02041900    GBBI01004395    JAC14317.1    GGMS01012005    MBY81208.1    ABLF02034467    GGMR01000676    MBY13295.1    NEVH01003017    PNF40781.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01020071    PNF21969.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01010546    PNF32261.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    ABLF02028535    ABLF02028545    NEVH01005938    PNF38077.1    NEVH01017559    PNF23833.1    NEVH01001355    PNF42855.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01012084    PNF30905.1    NEVH01000280    PNF43672.1    NEVH01021205    PNF19912.1    KQ973073    KXZ75680.1    GGMR01018716    MBY31335.1    NEVH01020940    PNF20481.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01023961    PNF17613.1    NWSH01000032    PCG80497.1    NEVH01014858    PNF27387.1    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    NEVH01006754    PNF36554.1    NEVH01006721    PNF37225.1    NEVH01002716    PNF41415.1    NEVH01007838    PNF34986.1    NEVH01019964    PNF22161.1    NEVH01026386    PNF14434.1    NEVH01017470    PNF24199.1    NEVH01011985    PNF31054.1    NEVH01000598    PNF43535.1    RPOV01000134    RPJ78669.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01019376    PNF22596.1    GGFJ01001857    MBW50998.1    NEVH01016302    PNF25823.1    GGFJ01001858    MBW50999.1    GFXV01006424    MBW18229.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01026154    PNF14491.1    GGMS01006359    MBY75562.1    LBMM01010106    KMQ87671.1    JRES01000644    KNC29657.1    PCG80496.1    NEVH01002704    PNF41489.1    AY060438    AAL25477.1    NEVH01012089    PNF30491.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
PF13358   DDE_3
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR038717   Tc1-like_DDE_dom       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
450
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.17979
Exp number, first 60 AAs:
0.00591
Total prob of N-in:
0.03678
outside
1  -  450
 
 

Population Genetic Test Statistics

Pi
8.731954
Theta
12.518617
Tajima's D
-0.695558
CLR
85.925828
CSRT
0.2002399880006
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号