SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02368
Annotation
PREDICTED:_uncharacterized_protein_LOC105387844_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 2.324
 

Sequence

CDS
ATGAGTCGCATTGCAGCGATAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACGAAGGAAAATGTCGCCGACGACGCCACTAGAGAGCTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGGAGTCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCAACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAAATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAGAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATTCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTGATCCACAATTGTCTTCCGTGTCGTATCCGCAAGGACACACCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACGTACGTGGGCCTCGATTACTTCGGACCCTATCATGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACACTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCAGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTATGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGAATTATCCAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAACAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGCTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCTCAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGAGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTGCGCACCGCCGGCGGTATCCTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCCGCCGCTCACCAGGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATAAAGAAACATAG
Protein
MSRIAAIEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWQQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILRINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYHVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQAMDKATEHEASLRIIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKLDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHKET

Summary

EMBL
AB042118    BAA95569.1    AB042119    BAA95570.1    KQ459986    KPJ18861.1    + More
AF530470    AAQ09229.1    NWSH01008670    PCG62455.1    ODYU01003174    SOQ41584.1    LNIX01000007    OXA52015.1    AAZX01023278    GDHC01018323    JAQ00306.1    LNIX01000019    OXA44812.1    LNIX01000004    OXA55241.1    GAKP01020709    JAC38243.1    JXUM01009840    KQ560293    KXJ83223.1    OXA44855.1    JXUM01130316    KQ567562    KXJ69370.1    JXUM01144298    KQ569759    KXJ68523.1    LNIX01000039    OXA39294.1    GEZM01052586    JAV74401.1    JXUM01013377    KQ560375    KXJ82728.1    AJVK01033431    GAMC01017930    JAB88625.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    JXUM01151198    KQ571164    KXJ68235.1    JXUM01031097    KQ560909    KXJ80382.1    GGFL01001682    MBW65860.1    JXUM01038372    KQ561162    KXJ79503.1    JXUM01005801    KQ560202    KXJ83866.1    GGFL01001842    MBW66020.1    KL367480    KFD71819.1    JXUM01162450    KQ574455    KXJ67869.1    KL367508    KFD68106.1    JXUM01083542    KQ563383    KXJ73941.1    AJVK01037041    JXUM01127084    KQ567147    KXJ69602.1    JXUM01020939    KQ560586    KXJ81781.1    AJWK01027898    LN877231    CTR11689.1    KL367687    KFD60188.1    GGFJ01000333    MBW49474.1    JXUM01122819    KQ566647    KXJ69950.1    OXA56250.1    GGFJ01000306    MBW49447.1    JXUM01136032    KQ568367    KXJ69026.1    GDIP01004568    JAM99147.1    GDIP01036233    JAM67482.1    JXUM01146045    JXUM01146046    KL363318    KFD47687.1    GEHC01000913    JAV46732.1    JXUM01111221    KQ565482    KXJ70922.1    GCES01096813    JAQ89509.1    AAGJ04043389    KL367650    KFD60758.1    AAGJ04001285    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    JXUM01013493    KQ560378    KXJ82704.1    OXA55408.1    UFQS01001138    UFQT01001138    SSX09193.1    SSX29102.1    AAGJ04040339    JXUM01049933    KQ561627    KXJ77955.1    GBYX01183181    JAO85198.1    GDIQ01143107    JAL08619.1    AAGJ04118726    AAGJ04091218    NSIT01000285    PJE78034.1    AJVK01034928    GCES01107353    JAQ78969.1    GDIQ01002920    JAN91817.1    AAGJ04095911    AAGJ04058558    GBYX01453073    JAO28442.1    GCES01095427    JAQ90895.1    MRZV01000084    PIK59375.1    JXUM01103818    KQ564835    KXJ71674.1    GDIQ01002921    JAN91816.1   
Pfam
PF17921   Integrase_H2C2        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF00665   rve
PF03564   DUF1759
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF00628   PHD
PF06677   Auto_anti-p27
Interpro
IPR040676   DUF5641        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR005312   DUF1759       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR000477   RT_dom       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR002999   Tudor       
IPR019786   Zinc_finger_PHD-type_CS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001841   Znf_RING       
IPR009563   SSSCA1       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       

Ontologies

Topology

Length:
636
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00261
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00074
outside
1  -  636
 
 

Population Genetic Test Statistics

Pi
158.006373
Theta
159.514512
Tajima's D
1.640979
CLR
178.763076
CSRT
0.815659217039148
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号