SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02349
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC034914?_partial_[Tribolium_castaneum]
Location in the cell
Cytoplasmic   Reliability : 1.898 Mitochondrial   Reliability : 1.424
 

Sequence

CDS
ATGGTTTTTAAAGTGTTACAGATAAATATAGACCGAGGGAAAGCTGCGCACGACCTACTTCTGGCAACTGCGAGCAGTATGAACGCGGATCTCGTGATGCTCTCTGAACCCAATAGAAAACTGGCAAAAGCTGCTGGATGGGAGTGCGACACCAGGGGAGATGCAGCCCTAGTGATTCTTAACAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTTGTTGGGTTCAAGATGAAGCACTTTGCCGCGTTCAGCTGTTACATATCTCCCAACTGCAGTTTTGAGGAGTTCAAAGCTGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGTAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTCGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCCAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATCAGTAATTGGCAAGTGCTCGACGAGGAGACCATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCCATCCCAGTGCTATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCAGTAAAAGCCTGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGTACACAAGGAATAACAAAAAGCTAGGAAAAGGGAAAGACAGGGAAAGTAACGAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAATAGTGTCAAAAAAGCTACGCGGAAACTCACCAATAAATATGGGCATGGCCCAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTTAGGAAAGCCCCAGGGCCCGACCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGGCAGAATAGAAAAACAACTAGTGCATTCGGACTGTTTACAAGATTCACAGTACGGGTTCAGAAAGGGGAGGTCCACAGTGGATGCAGCCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGTAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCGCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGCATTATACTGACAGACGCCGAGGGAGTGGTTGTAGAGAAAAAGGTTACCGGTGGTGTTCCGCAGGGCTCGATACTGGGCCCCACGCTGTGGAACATATTGTATGATGGGGTACTGCGCCTCGAACTGGGGGACGGGGCACAATTAATAGGCTTCGCTGACGATTTAGCTCTGGTGGTGTCAGCAAAGAAGGAAGCTGAACTGATGTCAATAGCGAATGTAGCCCTAGAGAAGATCAGCGCTTGGATGAAGCAAAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTGCTAAGTGGGCGAAGAAAGCTTAGCGAGATTTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTGAAATACCTCGGGTTTTGGTTTGACAAAAGTCTGAAGTTCGGCAAACACATTGAAGAAACAACTGGTAAAGCCGAAAGACTGACGACCGCCCTTGGCCAAATCATGCCCAGGAAAGGAGGGCCGAGGTCGAGCAAGCGCAGACTATTGGCGTCCGCAATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAAGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACCATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGATACCGATAGAACGGCTAGCAAAGGAACGGCAACGCTACTACCACGAGGGGACAAGAACAAGAGAAGAGGAAAGAGCACATACAATAAAAGAATGGGAACGAGACTGGCAGAAGGAGGGAAAAGGTAAGTGGACTCGTACAATCATACCCAACCTTAGGCTCTGGATGGGACGGAAACATGGCGAAACCGACAGACTGCTGACACAGGCCCTAAGTGGGCATGGAGTTTTCAACACTTACCTGCATGCAATAGGGAAAGCAGAAAGCGCAAGTTGCCCATACTGCGAACATGTTGACACACCGGAACATGCCCTATTTCAATGCATAAAGTTCTCAGAACTAAGAGAGAAAACGGAGGGAAGTGACGGAAAGGTGACTGTGGAAAACCTGATGGTGAGAATGATCCATAGTAAAGAAGAATGGGATAAATATGCGGGAATGCTCAAAGAGATAATGAGAGTGCGGGAAAAGGACGAAAGACTAAGGCAAAAATCTATCTATAATAATATATAA
Protein
MVFKVLQINIDRGKAAHDLLLATASSMNADLVMLSEPNRKLAKAAGWECDTRGDAALVILNKTLTVSEIYRGKGFVGFKMKHFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKVTNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVLDEETMSGHKYIAYEIKHVLPPSQCYAQMKRWNLQRLDVDKFSKSLKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRYTRNNKKLGKGKDRESNEENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKIVSKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDRIRLVLQKVLESGVFPNSWKTARLVLLRKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKQLVHSDCLQDSQYGFRKGRSTVDAANKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGVVVEKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAQLIGFADDLALVVSAKKEAELMSIANVALEKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGFWFDKSLKFGKHIEETTGKAERLTTALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWAKVMNVAKYRNMYSKVQRQLAIRICGAYRTISLDAVLVIAGLIPIERLAKERQRYYHEGTRTREEERAHTIKEWERDWQKEGKGKWTRTIIPNLRLWMGRKHGETDRLLTQALSGHGVFNTYLHAIGKAESASCPYCEHVDTPEHALFQCIKFSELREKTEGSDGKVTVENLMVRMIHSKEEWDKYAGMLKEIMRVREKDERLRQKSIYNNI

Summary

EMBL
KQ971388    KYB24913.1    AB593325    BAK38646.1    KQ972691    KXZ75806.1    + More
AB593321    BAK38639.1    ABLF02041886    KQ972544    KXZ75869.1    KQ971309    EEZ99146.1    KXZ75807.1    AB593323    BAK38643.1    GALX01005145    JAB63321.1    GFXV01003903    MBW15708.1    KQ971310    KYB29500.1    KYB29499.1    KQ972226    KYB24577.1    GFTR01008427    JAW07999.1    GALA01000302    JAA94550.1    GALA01001777    JAA93075.1    GALA01001776    JAA93076.1    AB593326    BAK38647.1    KU543683    AMS38371.1    ABLF02041557    GGFL01004044    MBW68222.1    GGFK01005660    MBW38981.1    GGFJ01001369    MBW50510.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01006838    MBY19457.1    ABLF02034925    GGFJ01001370    MBW50511.1    GGFJ01001439    MBW50580.1    GAKP01002292    JAC56660.1    GGFJ01001454    MBW50595.1    KXZ75870.1    GGFJ01001453    MBW50594.1    GFXV01002090    MBW13895.1    KU543682    AMS38369.1    KU543679    AMS38363.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GAMC01020517    JAB86038.1    ABLF02011183    ABLF02041884    GAMC01020519    GAMC01020515    JAB86040.1    ABLF02018942    ABLF02041885    AB593324    BAK38644.1    GGFJ01001727    MBW50868.1    GGFL01004046    MBW68224.1    AB090815    BAC57906.1    AB593327    BAK38648.1    GGFL01004047    MBW68225.1    GEHC01000915    JAV46730.1    GAPW01000192    JAC13406.1    KQ973343    KXZ75566.1    GGMR01019493    MBY32112.1    GBRD01017378    JAG48449.1    AB593322    BAK38641.1    KXZ75805.1    AB090814    BAC57904.1    GGFJ01001164    MBW50305.1    GGFM01001554    MBW22305.1    GGFJ01001165    MBW50306.1    KQ971675    KYB24771.1    GGFJ01001166    MBW50307.1    AJ278684    CAB99192.1    ABLF02021100    GGMR01015159    MBY27778.1    GGFJ01001541    MBW50682.1    AB090817    BAC57910.1    KQ973256    KXZ75595.1    ABLF02004854    ABLF02041317    AB090812    BAC57900.1    GGFK01007771    MBW41092.1    ABLF02014650    ABLF02009073    ABLF02030702    ABLF02042963    AAZX01012143    AAZX01012194    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    ABLF02007989    ABLF02011238    GGMR01004600    MBY17219.1    ABLF02018808    GGFL01001192    MBW65370.1    ABLF02023257    AB090813    BAC57902.1    M93690    AAA29363.1    AB090819    BAC57914.1    GGMR01012748    MBY25367.1    AB090821    BAC57918.1    GGMR01011682    MBY24301.1    AB090822    BAC57920.1    LBMM01006954    KMQ90166.1    GAMC01019173    JAB87382.1    GGFK01006563    MBW39884.1    ABLF02021645    GGFL01001916    MBW66094.1    AB090820    BAC57916.1    ABLF02030663    ABLF02041312    GALX01004171    JAB64295.1    GGFL01001189    MBW65367.1    GGFL01001190    MBW65368.1    GGFL01001583    MBW65761.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF12017   Tnp_P_element
PF13966   zf-RVT
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000663   Natr_peptide       
IPR021896   Transposase_37       
IPR026960   RVT-Znf       
IPR016067   S-AdoMet_deCO2ase_core       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
SSF56276   SSF56276       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=1.41205e-10,     Score=163

Ontologies

Topology

Length:
986
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
14.21218
Exp number, first 60 AAs:
0.00482
Total prob of N-in:
0.00034
outside
1  -  986
 
 

Population Genetic Test Statistics

Pi
3.474093
Theta
11.32497
Tajima's D
-1.954946
CLR
160.449003
CSRT
0.0177491125443728
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号