SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02348
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC012926_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.855
 

Sequence

CDS
ATGGAGCGGGTAACTATAAGATACAAGGACGATACAAATAAACCATCAGAAATGGAGCAAAAGTTTGAAGCTTACAAAAAGGAGCAAGAAGAAAAGATCAGGAGACTAGAACAAGAAATTAAGGAACTCAAGACACTGCATAAACGAGAAACTGGAGAGAACCAACTTTTCAAGCTTGACGATCAGATGATTGACAGCTATGACGACTTCTCGAAAGTTTCAAGCATGGACTGGACGCAGGACAGTTACAAAAGGACAAAGATAGGCCATGGAGACATTTTCCTGAGAACCACCGACTGTATAGTCTACTTCTGTGATGAGAGGGAAAAGGCACACTCGAGGCTGACAAGGAGGGTGCTAAGCCGATATCCAGAAGTGACTAAGGGCGAGAAAATGGCATGCGCAGGAGGAGCATACGTGACGGTGGAACGAGAAACCACCATCAAAACAAAAGAGGGGAGACAGACAGACAAAACGAGTGCTGTGATCATGTTCCATGATGCGACCAAACAGGACGGCCGAAGTCAAAAGGACATGTATGAGCTTCTGTCAGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTAACGATTATAAAGCCCCAAGGAATCGATACAGGTGTAACAAGGAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCAAACTAGAATTAAGGACACCTAAAAAAGGAGAAAATACAAACAATACGGAAACAAGAAAACGAGACGAGGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCGTCTCTAGAAAACATAAAAGGTGTAAAAAAGACAGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACAGGGAAAATAAGAGAAATGATGCGAGACAGAAAGGTAAGAAGAACTGGGGGGAGCAAAAAAAAAAGTAATACACATAAAGGGAATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAAAAGTAGACAGCTTGGAGATAAGATCACTGAGACCGATGGGCGGTGGAAACCAGACGGCAACAGTGATCCTGGATGA
Protein
MERVTIRYKDDTNKPSEMEQKFEAYKKEQEEKIRRLEQEIKELKTLHKRETGENQLFKLDDQMIDSYDDFSKVSSMDWTQDSYKRTKIGHGDIFLRTTDCIVYFCDEREKAHSRLTRRVLSRYPEVTKGEKMACAGGAYVTVERETTIKTKEGRQTDKTSAVIMFHDATKQDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVTRKMLEVLFRGKDIKLELRTPKKGENTNNTETRKRDEVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMRDRKVRRTGGSKKKSNTHKGNGQLGGNGGSKGGLKVDKLDKKSRQLGDKITETDGRWKPDGNSDPG

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
374
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.06621
outside
1  -  374
 
 

Population Genetic Test Statistics

Pi
3.570138
Theta
8.81735
Tajima's D
-1.8459
CLR
162.027348
CSRT
0.0217989100544973
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号