SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02337
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Sodium/hydrogen exchanger      
Location in the cell
Mitochondrial   Reliability : 2.092 Nuclear   Reliability : 1.572
 

Sequence

CDS
ATGGCAACCCCCCCCAACATGGCTGACACAAATAAAAACTGGCCCCCAGTCCCCGGCAGCTCCGCTATTCCTGGCTACGGTAGCGGTCAAGGTAACGGCGGGGCAGGGGGTGCTAAGAATCTCCGGCAGAGATCCGGCTACCATAAAAAACGACGACTGGACCTGGCAACATACAACGTGCGAACACTGCGGACCGATGAGAAGATTGTGGAACTCGAGGAAGAATTGAGCAGGTTACGGTGGGACATTGTGGGCTTATCTGAAGTCCGAAGAGAGGGAGAGGACACGATAACTCTGAGGTCCGGTAACTTGCTCTATTTTCGAGAAGGTGATCATCTGTCTCAAGGCGGTGTCGGATTTTTCGTCCACAAGTCCCTTGTGAATAATGTGCTCAAAATCGAGAGTGTGTCAACCAGGGTGGCGTACCTTGTACTCAGAATCACCAAAAAGTATTCGTTGAAGATCATACAGGTTTACGCTCCGACCTCGGCACACTCCGACGATGAGGTAGAGACTATGTATGAGGACATTTCCAGAGCCATGCATAGCTTTAAAACTCACATCACCATTGTCATGGGGGATTTCAACGCCAGACTGGGTAAACGGTCCGAGGGGGAGCTGCGAGTGGGACCATTTGGATTTGGGAATCGAAATCATCGGGGAAACCTACTTGCCGGTTTCATGGAGAAAGAAGAATTATTTATGATGAACTCTTTCTTCCAAAAACGGAATCACAGGAAGTGGACCTGGATGAGCCCCAATGGTGCCATCAAAAATGAGATAGATTTCATTATGTCGACAAAAAGGCAAATATTCAATGATGTCTCTGTGATCAATATGGTTAAAACAGGAAGTGATCATCGGATGGTAAGAGGCACATTGAACCTCAATATTAAGCTTGAGAGATTCCGACTGATAAGGTCTACGCTCCGTCCAGCACCAGCTCAGATCCAAAGTTCTGGGCACTTTCAGCTCGAACTTCAAAACCGCTTCGATTGCCTAGGAGGCTCCGTGGACGATTACAATGACGGGTTTGTGAATGCTGTCCATACGATTGGTTCCAAGTTTTTTGGAGCCCGTCGTACAAACAGAACCAAAAAACTCTCAGACCCTACTCTCAAACTCATGGAAGAACGTCGCGGAATGATTTTGCAGTCTTCAGAAGATTCGTTTAAATATCGGTCTCTCAACAGACAGATCTCAAAGTCTCTTAAATTTGATCTACGCCGTTTTAATACTGAGCGTATTAAAGAGGCTATAGAACGAAACAAAGGCTCCAAGGTGTTCGCGAGAGATTTGTCTCTTGGGAAAAGCCAGTTGACAAGACTGAAGATCGATGATGGCAGGATCATTTCGTCCAAGCCTGAGCTTTTGAGAGAGGTCGAGAAGTTCTATGGACAGCTATACACATCTACTCGACAACCCGTGGAATATCTAGCAAAGGATCCAAGAGCTAGATTAGTCCGACACTATACCGAAGATATCCCCGACATCAGCCTGTGCGAGATTAGAATGGCTCTCAAGCAACTTAAGGACAACAAGGCACCGGGCGAGGATGGAATTACCGTCGAACTTCTGAAGGCGGGTGGAAAACCAGTCCTTCGGGCCCTACAAAATTTATTTAATTCCGTCATTCTCGATGGGAATGTGCCCCTGGCATGGACCAGAAGTGTGGTGGTACTGTTCTTCAAAAAGGGTGACAATACTCGTTTGAAGAATTATAGACCCATCTCACTTCTGAGTCATGTCTATAAGTTGTTCTCGAGAGTTATTACGAACCGTCTCGCGCGCAGGTTTGATGACTTCCAGCCACCCGAACAAGCCGGTTTCCGAAAAGGCTATAGTACCGTAGACCACATTCATACGTTGCGGCAGATTGTACAAAAGACCGAGGAATATAACCTGCCGCTTTGCTTAGCATTTGTGGACTACGAGAAAGCCTTTGATTCGATTGAAACCTGGGCCGTGTTACAGTCTCTCCAACGGTGCCAAATTGATTATCGGTATATCGAAGTGTTGAGGTGTTTGTATGAAAACGCTACTATGTCAGTCCGAGTACAGGACCGGGCTTCAGAACCTATCCTTCTGCAGCGGGGCGTGAGGCAAGGAGATGTTATTTCTCCGAAACTATTTACCGCTGCGCTGGAAGATGTTTTCAAAGTTCTGGACTGGAAAGGACTAGGCATCAACATAAACGGCGAGTACATAACTCACCTTCGGTTCGCCGATGATATTGTGATTATGGCCGAGACCATGGAGGACCTCAGTACAATGCTCAAAGACCTCAGTAGGGCTTCTATCCGAGTGGGTCTAAATATGAACAAAGAAAAAACAAAAATTATGTTGAATGCTCATGTAGCGCCCACTCCAGTAAAGATCGGAGGCTCTACGCTCGAAGTTGTTGACGAGTATATTTACCTGGGACACACTGTCCAGCTAGGTAAGTCCAACTTCGAAAAAGAGGTCAACCGTCGAATCCAGCTCGGATGGGCAGCGTTCGGAAAGCTACGTAAAATCTTCTCATCACAAATACCACAGTGTCTCAAGACGAAAGTCTTTGACCAGTGTGTGTTGCCAGTGATGACATATGGCACTGAGACGTGGTCGCTCACAATGGGCCTTATGAGAAGGCTCAAGGTCACCCAAAGAGCAATGGAGAGGGCTATGCTCGGAGTTTCCCTGCGAGACCAAATCAGAAATGAGGAGATTCGCAGGAAAACCATGGTAACCGACATAGCCCAAAGGATTGCGACACTGAAGTGGCAGTGGGCAGGACACATTGCTCGCGGAACAGATGGCCGTTGGGGCCAGAAGGTTCTTGAGTGGCGACCGCGTACTGGGAGACGTAGCGTGGGTAGGCCTCCCACAAGGTGGGCCGACGACCTATTAAGGTTCGCGGGGATCCGCTGGATGCAGGCAGCGCAGGACCGGTCTTTGTGGCAAGGCTTGGGGGAGGCCTATGTCCAGCAGTGGACGTCCATGGGCTGA
Protein
MATPPNMADTNKNWPPVPGSSAIPGYGSGQGNGGAGGAKNLRQRSGYHKKRRLDLATYNVRTLRTDEKIVELEEELSRLRWDIVGLSEVRREGEDTITLRSGNLLYFREGDHLSQGGVGFFVHKSLVNNVLKIESVSTRVAYLVLRITKKYSLKIIQVYAPTSAHSDDEVETMYEDISRAMHSFKTHITIVMGDFNARLGKRSEGELRVGPFGFGNRNHRGNLLAGFMEKEELFMMNSFFQKRNHRKWTWMSPNGAIKNEIDFIMSTKRQIFNDVSVINMVKTGSDHRMVRGTLNLNIKLERFRLIRSTLRPAPAQIQSSGHFQLELQNRFDCLGGSVDDYNDGFVNAVHTIGSKFFGARRTNRTKKLSDPTLKLMEERRGMILQSSEDSFKYRSLNRQISKSLKFDLRRFNTERIKEAIERNKGSKVFARDLSLGKSQLTRLKIDDGRIISSKPELLREVEKFYGQLYTSTRQPVEYLAKDPRARLVRHYTEDIPDISLCEIRMALKQLKDNKAPGEDGITVELLKAGGKPVLRALQNLFNSVILDGNVPLAWTRSVVVLFFKKGDNTRLKNYRPISLLSHVYKLFSRVITNRLARRFDDFQPPEQAGFRKGYSTVDHIHTLRQIVQKTEEYNLPLCLAFVDYEKAFDSIETWAVLQSLQRCQIDYRYIEVLRCLYENATMSVRVQDRASEPILLQRGVRQGDVISPKLFTAALEDVFKVLDWKGLGININGEYITHLRFADDIVIMAETMEDLSTMLKDLSRASIRVGLNMNKEKTKIMLNAHVAPTPVKIGGSTLEVVDEYIYLGHTVQLGKSNFEKEVNRRIQLGWAAFGKLRKIFSSQIPQCLKTKVFDQCVLPVMTYGTETWSLTMGLMRRLKVTQRAMERAMLGVSLRDQIRNEEIRRKTMVTDIAQRIATLKWQWAGHIARGTDGRWGQKVLEWRPRTGRRSVGRPPTRWADDLLRFAGIRWMQAAQDRSLWQGLGEAYVQQWTSMG

Summary

Similarity
Belongs to the integrin beta chain family.
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Integrin beta
EMBL
FJ265549    ADI61817.1    FJ265543    ADI61811.1    RSAL01000057    RVE49824.1    + More
FJ265544    ADI61812.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    FJ265551    ADI61819.1    RSAL01000220    RVE44071.1    KZ149907    PZC78256.1    ODYU01004088    SOQ43598.1    GBBI01004876    JAC13836.1    FJ265564    ADI61832.1    FJ265561    ADI61829.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    FJ265562    ADI61830.1    GBBI01004877    JAC13835.1    MRZV01002136    PIK34564.1    FJ265563    ADI61831.1    JARK01001655    EYB84321.1    GDKW01001596    JAI54999.1    JARK01001354    EYC21986.1    DS268444    EFP01729.1    DS268591    EFO92565.1    JARK01001370    EYC16150.1    JARK01000173    EYC41342.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01000388    EYC37469.1    GBGD01000380    JAC88509.1    ODYU01008249    SOQ51673.1    JARK01001711    EYB81734.1    JARK01001621    EYB86109.1    JARK01000460    EYC36749.1    JARK01001626    EYB85833.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001340    EYC30828.1    JARK01001730    EYB81048.1    JARK01001543    EYB91356.1    DS268505    EFP13372.1    JARK01001353    EYC22263.1    AF054983    AAC72298.1    DS268655    EFO97114.1    JARK01001395    EYC09730.1    EYC09729.1    DS268752    EFP01106.1    JARK01001505    EYB94618.1    EYB94617.1    JARK01001459    EYB99276.1    JARK01000343    EYC38099.1    EYB99275.1    GBGD01000453    JAC88436.1    JARK01001438    EYC02111.1    EYC21713.1    QFQQ01000179    PZR20596.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001531    EYB92324.1    EYC16376.1    JARK01001475    EYB97550.1    JARK01001421    EYC04912.1    EYC30744.1    JARK01001346    EYC26445.1    JARK01000063    EYC44387.1    EYC33297.1    JARK01001344    EYC28216.1    JARK01001497    EYB95322.1    JARK01001389    EYC10874.1    JARK01001401    EYC08686.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00362   Integrin_beta
PF13520   AA_permease_2
PF00201   UDPGT
PF03372   Exo_endo_phos
PF00069   Pkinase
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR020846   MFS_dom       
IPR002293   AA/rel_permease1       
IPR002213   UDP_glucos_trans       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
IPR000719   Prot_kinase_dom       
IPR001507   ZP_dom       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF56112   SSF56112       
Gene 3D
PDB
6AR3     E-value=2.78436e-06,     Score=126

Ontologies

Topology

Subcellular location
Membrane  
Length:
995
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02371
Exp number, first 60 AAs:
0.00082
Total prob of N-in:
0.00008
outside
1  -  995
 
 

Population Genetic Test Statistics

Pi
14.344572
Theta
18.816744
Tajima's D
-0.967766
CLR
40.119689
CSRT
0.138243087845608
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号