SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02336
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.01 Nuclear   Reliability : 1.375
 

Sequence

CDS
ATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGTAGAGCTGCTGGCCGATACATTGCAAGCCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAACCCGGTAAACAAAAAAATCATCCGACGAGCCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCCCGGAGTACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGAATAGTCTCGTGCTCGTCATAAGGGACTTCTTGTCGAACCGCTCTTTCGATATCGAGTCGAGGGAACCCGCTCCTACCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACTCCTCCTATTTAGCTTATTCGTCAATGATATTCCCGGGTCGCCGCCGACCCAGTTAG
Protein
MPPLVGPSGRLAAFDDDEKVELLADTLQAQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKQKNHPTSRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLPEYILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPNSLVLVIRDFLSNRSFDIESREPAPTHDLSQLESRKALSSHSSYLAYSSMIFPGRRRPS

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973412    EFA12510.2    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GGMS01002955    MBY72158.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMR01006581    MBY19200.1    KQ973213    KXZ75606.1    GGMR01015412    MBY28031.1    KK113655    KFM60720.1    ABLF02040174    ABLF02040183    ABLF02055266    GFXV01007093    MBW18898.1    GECU01013097    JAS94609.1    GALX01005299    JAB63167.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01008766    MBY77969.1    GGMR01014053    MBY26672.1    GGMS01000737    MBY69940.1    ABLF02003961    ABLF02059872    GALX01005359    JAB63107.1    GGMS01006359    MBY75562.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    GBBI01001646    JAC17066.1    GGMS01000625    MBY69828.1    GBBI01004395    JAC14317.1    GGMS01018022    MBY87225.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02036422    ABLF02042484    GGMS01005381    MBY74584.1    GGMS01017914    MBY87117.1    GGMR01018716    MBY31335.1    ABLF02033757    ABLF02016634    GGMS01017365    MBY86568.1    ABLF02003242    ABLF02006260    ABLF02042516    ABLF02055645    KK119261    KFM75202.1    GGMR01000676    MBY13295.1    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02042385    GGMS01015632    MBY84835.1    AY060438    AAL25477.1    IAAA01035749    LAA09611.1    KK112269    KFM57234.1    GGMR01012305    MBY24924.1    NNAY01003095    OXU19992.1    GBBI01001642    JAC17070.1    GGMS01009480    MBY78683.1    ABLF02020655    ABLF02039168    ABLF02061060    ABLF02041767    GAHY01000238    JAA77272.1    GGMR01003407    MBY16026.1    ABLF02008933    ABLF02034467    JXUM01241784    KQ635293    KXJ62492.1    ABLF02037660    GGMR01000086    MBY12705.1    GGMR01000005    MBY12624.1    NEVH01013558    PNF28668.1    ABLF02004232    ABLF02004856    ABLF02004857    ABLF02035566    ABLF02056910    NWSH01000032    PCG80497.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
296
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
10.75466
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04537
outside
1  -  296
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
51.790308
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号