SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02333
Annotation
PREDICTED:_uncharacterized_protein_LOC105664173_[Megachile_rotundata]
Location in the cell
Nuclear   Reliability : 2.979
 

Sequence

CDS
ATGGAGAAATTAAGATTTGATTTTACAATGAAATCAATGGCGGATGGAAAAACAAACGTCATATGCATAACTTCCATTGCTACACAAAGTGGACAAGTTTTTGGAATTCCAGTCGAATATCAACCCGTAAATCTTCATAAGGTGATCACAACTACTCCTAACTACACCAGAGTAAAAAACTCTTTAGTAAAAAGGCATCAAACGAGGAAAATATGTATAACTGTGACGGAGGAAATTTCAAAAACATATTTGGATGAAGAACAAAATTTGCAATTCAATGATTGTTATTTGGAAGAGATTTCAGAACAACCTGTTAGTTATGAATCGACATCTAGTAATTCTAATCACATGCTTGAAAAACTGTTAGAAAAACTACAAGAACAAAAACAGCAGAAACCAGAAAAACAAAATTTAGGGAAAATTGCAAAGGATTTTATTATAGAAAAATTCAACGGCCGTAATTCAAATGCATTACAGTGGATCAAAGATTTTAATAAAGAATGTGAACGTTTTCAAATAAACGAGGATAAACAAAAAATTGAAATTTTGAAGAACTTCTTAGAAAACGCTAGTGTAGATTGGTATAGTTGTATGCTGATGAAGCTTACAGTACAATCAGAATGGAGCAAATGGGAGAAAATTTTCTGTGAGACATTTGCGAACAAAGGATGGTCCTCCACTAGATATGCTCTTGCCTTTAAATATCAATCGGGATCCTTGCTTGAGTATGCTTTAAAGAAGGAGAAATTATTGTTGGAAGTCAGACAGTGGATACCGGAACAATTATTGATCTCATAG
Protein
MEKLRFDFTMKSMADGKTNVICITSIATQSGQVFGIPVEYQPVNLHKVITTTPNYTRVKNSLVKRHQTRKICITVTEEISKTYLDEEQNLQFNDCYLEEISEQPVSYESTSSNSNHMLEKLLEKLQEQKQQKPEKQNLGKIAKDFIIEKFNGRNSNALQWIKDFNKECERFQINEDKQKIEILKNFLENASVDWYSCMLMKLTVQSEWSKWEKIFCETFANKGWSSTRYALAFKYQSGSLLEYALKKEKLLLEVRQWIPEQLLIS

Summary

EMBL
KQ982715    KYQ51731.1    JTDY01017365    KOB51853.1    JTDY01008086    KOB64751.1    + More
AMQM01002082    KB097700    ESN91473.1    JTDY01005843    KOB66552.1    JTDY01001358    KOB74090.1    AMQM01001573    AMQM01001574    KB097571    ESN94358.1    LBMM01014575    KMQ85130.1    LBMM01023341    KMQ82740.1    AMQM01004377    KB096502    ESO04465.1    KQ460499    KPJ14273.1    KQ460501    KPJ14173.1    ABLF02008319    ABLF02039706    GL763118    EFZ20161.1    AGBW02008978    OWR52011.1    ODYU01007023    SOQ49389.1    KQ977673    KYN00612.1    AMQM01005555    KB096983    ESO00269.1    CH933817    KRG07776.1    AMQM01002557    AMQM01002558    AMQM01002559    KB095812    ESO11752.1    ACPB03003915    GEDC01029643    GEDC01008571    GEDC01007985    JAS07655.1    JAS28727.1    JAS29313.1    KQ980716    KYN14207.1    KQ976913    KYN07139.1    KQ977377    KYN03200.1    KK854406    PTY15552.1    KK855443    PTY22588.1    KK855666    PTY23463.1    AMQM01001240    KB097143    ESN99416.1    AMQM01003909    KB096365    ESO05283.1    AMQM01004332    ESO04369.1    AMQM01005146    KB096830    ESO01074.1    AMQM01011378    KB096295    ESO06747.1    AMQM01003919    AMQM01003920    ESO05345.1    KK854101    PTY11289.1    AMQM01001502    ESN94174.1    AAZX01023363    GL766977    EFZ14439.1    AMQM01005441    KB096945    ESO00403.1    AMQM01002230    AMQM01002231    KB097753    ESN90333.1    AMQM01005502    ESO00169.1    KQ976921    KYN07071.1    NCKU01010003    RWS01022.1    NCKU01005203    RWS04879.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00078   RVT_1
Interpro
IPR012337   RNaseH-like_sf        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041577   RT_RNaseH_2       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
265
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0992299999999999
Exp number, first 60 AAs:
0.09902
Total prob of N-in:
0.03249
outside
1  -  265
 
 

Population Genetic Test Statistics

Pi
3.883158
Theta
19.236997
Tajima's D
-1.532932
CLR
56.867268
CSRT
0.0540972951352432
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号