SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02332
Annotation
Retrotransposable_element_Tf2_155_kDa_protein_type_1_[Papilio_machaon]
Full name
SAGA-associated factor 11      
Location in the cell
Nuclear   Reliability : 4.382
 

Sequence

CDS
ATGGATATTTTTGTGGTGGATAATGAAAATTTTAACTATGACTTCTTAATTGGTTTGGATTGTATAAAAAAATTCAAATTAATACAAAATGAAGAACTTAACATCATACAATATCCCGAAAAGAAAAGCATAATCTCAAATGAACATTGTTCTAATGAGAATGTAACAAATGTCGGAATTCCTGATGTACTAGGTGACAAAAATAAAGAACAAACATTTAAAGAGAGAATAGAAGAGAAAGAGAAGATAGAGATGGAACTATACTCTGAGATAGTAAAAAAGGGTACTACTATAAATACCAACAAATTGTGTGAAATTAATTTCAATGAACATGTAAACATTGATGAATTTCAAATGTCTGTAAATCATCTAGATTTATATCAGCAATCAAAAATTGAGAAGTTAGTAGATAAATACAAATCTGTTTTTGCTAAGGACAAATATGATGTTGGCTCTGTGCAGGATTATGAAGCCCATATAGACTTGATGGTAGATAAATACTGCTATAAGCGTCCGTACAGATGCACAATTGAAGACAGAACAGAAATTGAAAGTCAAATATCGAAGCTACTACAGAAAAATTTGATAGAGGAATCTTACAGCCCGTTTGCTGCTCCTGTAACTCTAGCATATAAGAAAGAAGATGATAAAAAAACAAGATTATGCATAGATTTCAGAGATTTAAACAAAATAGTAGTTCCACAATCACAACCTTTCCCACTTATAGAGGACTTAATGACCAAAACAGTAAACTGTAAGTATTATTCTACATTAGACATAAACTCAGCATTTTGGTCGATCCCATTGAAAATTCAAGATAGACATAAGACTGCTTTTGTGACACAAGAAGGACATTTTCAATGGACTTGTCTCCCATTTGGGTTAAAGACTGCACCAGCGATTTTCCAAAGAATATTGAGCAATATTATAAGAAAACACAGACTATCTAACTTTGCAGTAAACTTTATTGACGACATCTTAATTTTTTCTAAAACTTTTGAGGAACATATACAACACATATCGAGACTACTGGAAGCAATACAAAAGGAAGGGTTTAGACTGAAGTTTTCAAAATGTACATTTGCAAGTCACCATGCTAAATACTTGGGTCATATAATAGAAGACAATTCAGTTAGACCTCTGAAAGATTATTTAACTGCTGTCAAAAGCTTCCCAATTCCAGAAACAAGCAAAAATATACGGCAGTTTTTGGGAAAAGTAAATTTTCATCATAAGTTTGTACCACATAGTGCAATTATCCTCGATCCATTACATAACTTATTAAGGAAAGATGTGAAATTTGTATGGACGGCAGAATGCCAGGAAGCATTTGATAAAATTAGAGCATTGCTTTGCTCAGAACCAATCCTAAAAATATTTGACCCAGATTCACCGATAAGAATTTACACAGATGCTAGTATCAAAGGAGTTGGAGCAGTGTTGAAACAAGACGATGAAAACGGCGTGAGTAAACCGGTTGCTTATTTTTCGAAGAAATTAACAGAAGCACAGAAAAAGAAGAAGGCAATATACTTAGAATGTCTGGCGATAAAAGAAGCAGTCAAATACTGGCAACATTGGCTTATGGGAAAAGAATTTTTGGTATACACAGATCATAAACCCCTGGAAAATATGAACATTAAAGCTCGAACTGATGAGGAACTAGGTGATTTAACATATTATCTATCACAATATAATTTTGAAATTAAATACAACCCAGGAAAATCAAATCAAGAAGCGGACTGCTTAAGCCGAAATCCAGTCCTAGAAGCAAATGATAATAACGACGATTTTTTAAAGGTCGTAAATTTAATCGACCTACAAGAAATAAAGAATGACCAGCTAACAAATCCAGACCTACAAAAAGAAAAGAATAAGCACATATTAGAGAATGAAGTTTATTACAAGAAAAATAAAAGAAGAAATAAGATTATACTGTCAGAAAAACTTAGCAAAGCTCTAATAAAAAAAGTCCATGACACATACTGCCACATTGGAAGAACCCAGATGACAAATAAAATAACACCATTCTTTTCAGCCAAGAATATTACAGCAAACATTAATAAAATGTGTGATGCGTGTGAAACCTGCATTAAAAACAAGTCCAGGAGGAAGTCGAAATATGGTTTAATGTCACATTTGGGACCAGCCACACACCCGTTTGAAATTGTATCCATCGATACTATTGGGGGCTTTGGAGGATCCCGATCAACCAAAAGAGAAGGGTATAAATTGGAAGAAGGAGATAGTGTTTATGTGGAGAATGGAAATAAACTAAACAGGAAGAAAATGGATGAATTGAGAACAGGGCCATACAAAATACTAAAGAAGATTTCAGAATCGATCTATGAAGTTGACACCGGACACAAAAAAGCAGAATCAAACCTCTATCATATAACAAAGTTGTCTCCAGTGTCTATCTGA
Protein
MDIFVVDNENFNYDFLIGLDCIKKFKLIQNEELNIIQYPEKKSIISNEHCSNENVTNVGIPDVLGDKNKEQTFKERIEEKEKIEMELYSEIVKKGTTINTNKLCEINFNEHVNIDEFQMSVNHLDLYQQSKIEKLVDKYKSVFAKDKYDVGSVQDYEAHIDLMVDKYCYKRPYRCTIEDRTEIESQISKLLQKNLIEESYSPFAAPVTLAYKKEDDKKTRLCIDFRDLNKIVVPQSQPFPLIEDLMTKTVNCKYYSTLDINSAFWSIPLKIQDRHKTAFVTQEGHFQWTCLPFGLKTAPAIFQRILSNIIRKHRLSNFAVNFIDDILIFSKTFEEHIQHISRLLEAIQKEGFRLKFSKCTFASHHAKYLGHIIEDNSVRPLKDYLTAVKSFPIPETSKNIRQFLGKVNFHHKFVPHSAIILDPLHNLLRKDVKFVWTAECQEAFDKIRALLCSEPILKIFDPDSPIRIYTDASIKGVGAVLKQDDENGVSKPVAYFSKKLTEAQKKKKAIYLECLAIKEAVKYWQHWLMGKEFLVYTDHKPLENMNIKARTDEELGDLTYYLSQYNFEIKYNPGKSNQEADCLSRNPVLEANDNNDDFLKVVNLIDLQEIKNDQLTNPDLQKEKNKHILENEVYYKKNKRRNKIILSEKLSKALIKKVHDTYCHIGRTQMTNKITPFFSAKNITANINKMCDACETCIKNKSRRKSKYGLMSHLGPATHPFEIVSIDTIGGFGGSRSTKREGYKLEEGDSVYVENGNKLNRKKMDELRTGPYKILKKISESIYEVDTGHKKAESNLYHITKLSPVSI

Summary

Similarity
Belongs to the SGF11 family.
Belongs to the tubulin family.
EMBL
KQ460869    KPJ11799.1    GGMR01004768    MBY17387.1    GDAI01002358    JAI15245.1    + More
KQ460501    KPJ14174.1    LBMM01012506    KMQ86187.1    GEDC01029866    JAS07432.1    GEDC01007645    JAS29653.1    GEDC01003500    JAS33798.1    GDAI01002319    JAI15284.1    GGMR01019146    MBY31765.1    KK854406    PTY15552.1    KK855443    PTY22588.1    GEDC01020941    JAS16357.1    IAAA01005657    LAA02892.1    IAAA01005656    LAA02887.1    KK117876    KFM71643.1    CAEY01001805    CAEY01001938    CAEY01000944    GACK01004001    JAA61033.1    GACK01004074    JAA60960.1    GBYB01013920    JAG83687.1    BFEA01000059    GBG65156.1    GBIH01000760    JAC93950.1    GFAA01003618    JAT99816.1    GACK01009237    JAA55797.1    GACK01009039    JAA55995.1    GACK01009040    JAA55994.1    BFEA01000202    GBG74403.1    GFAA01003652    JAT99782.1    GACK01009043    JAA55991.1    GACK01000334    JAA64700.1    GACK01009195    JAA55839.1    GFAC01005811    JAT93377.1    BFEA01000446    GBG83646.1    GACK01009041    JAA55993.1    BFEA01000891    GBG91289.1    GEGO01003466    JAR91938.1    GACK01003086    JAA61948.1    BFEA01002572    GBG41953.1    BFEA01000209    GBG74741.1    GEZM01081635    JAV61573.1    GACK01004027    JAA61007.1    GBG74399.1    GACK01003662    JAA61372.1    GACK01009547    JAA55487.1    BFEA01000076    GBG66617.1    BFEA01000162    GBG72311.1    BFEA01000235    GBG75978.1    BFEA01000347    GBG80460.1    BFEA01000451    GBG83778.1    BFEA01000163    GBG72342.1    GACK01000375    JAA64659.1    GACK01009357    JAA55677.1    GGLE01001609    MBY05735.1    BFEA01000020    GBG61486.1    BFEA01000222    GBG75323.1    BFEA01000245    GBG76456.1    BFEA01000809    GBG90415.1    GGLE01003869    MBY07995.1    BFEA01000123    GBG70001.1    GEZM01089268    GEZM01089261    JAV57577.1    GEZM01089269    GEZM01089265    JAV57567.1    GGLE01007069    MBY11195.1    GEGO01004488    JAR90916.1    GACK01000487    JAA64547.1    BFEA01000178    GBG73141.1    BFEA01000273    GBG77650.1    GAKP01014483    JAC44469.1    GEGO01007454    JAR87950.1    KQ971338    KYB27888.1    GACK01009042    JAA55992.1    GEFM01006973    JAP68823.1    KYB27887.1    GEGO01004785    JAR90619.1    BFEA01000043    GBG63850.1    BFEA01000021    GBG61643.1    DNYW01000170    HBK71150.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF13358   DDE_3
PF01498   HTH_Tnp_Tc3_2
PF08209   Sgf11
PF09668   Asp_protease
PF00098   zf-CCHC
PF14392   zf-CCHC_4
PF00091   Tubulin
PF03953   Tubulin_C
PF00077   RVP
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR041373   RT_RNaseH       
IPR002492   Transposase_Tc1-like       
IPR038717   Tc1-like_DDE_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR013246   SAGA_su_Sgf11       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR001878   Znf_CCHC       
IPR016197   Chromo-like_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR034122   Retropepsin-like_bacterial       
IPR017975   Tubulin_CS       
IPR037103   Tubulin/FtsZ_C_sf       
IPR003008   Tubulin_FtsZ_GTPase       
IPR008280   Tub_FtsZ_C       
IPR000217   Tubulin       
IPR018316   Tubulin/FtsZ_2-layer-sand-dom       
IPR023123   Tubulin_C       
IPR002454   Gamma_tubulin       
IPR036525   Tubulin/FtsZ_GTPase_sf       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54160   SSF54160       
SSF57756   SSF57756       
SSF52490   SSF52490       
SSF55307   SSF55307       
PDB
4OL8     E-value=1.46448e-70,     Score=680

Ontologies

Topology

Subcellular location
Nucleus  
Length:
807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0095
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  807
 
 

Population Genetic Test Statistics

Pi
13.168701
Theta
23.374272
Tajima's D
-1.03803
CLR
57.554658
CSRT
0.131293435328234
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号