SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02313
Pre Gene Modal
BGIBMGA001398
Annotation
PREDICTED:_uncharacterized_protein_LOC105389720_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.258
 

Sequence

CDS
ATGACGACCCGCATTTTAAAATGTAGTAATTGCAACATCGTGATTTGTGAAGTGCTTGCTGTCATACAAAATAAAATAGATGTGATGAGTGAAGACAGTTTGGTGCGTATATGTTCAACGTCTTTCTCCGTGGAAGAAATTGAAAATGCTAAAAGCCTTTTGTTTGAATCTGTGACGACTTCAAAACGAAAGAGAACACGTAGAAGGGAAGGCCGAATGCATCGCGATCTTTTTGATGTTATCAGTCTTTTTAAAGAAACTGACCCGGAATTAACTCCAACTTTTGTGGCTAGAGATTTGCAAAAGTTACCGCCTGTACATTTTGATCATCTCGACGCGACTAAGCTTTTAAAAGACATACTCGTCATCCAAAAGAAGATACAAACAATTAAGGAATCATATGTAACGGAGGATAATTTAAATGAAATAAAAAATGAACTTTATAATCTGAAAAGTGCATCTTTAGTGAATAATAACTTCGATATACATAACACCGAGGGTCACATTAATACAAAGAGAGGCGGGGGTATACTAACGAATAGTTATTACTTAGACAGTAGCCCGATCGAGCCACCTTATTGTTCACACGCGGAGGTAAGCATTGCAAATCATGAGCATGAGCGCTCCTCCGCCACCGCCACGGCCGCCGCCACTGGCCTCGATACTGGCGATCGGCGCGTGGAGTTCGTCGTCGGAAACTTCAGTACTGCGGCTTTGAACGGGAATACGTTTGCGCCTGCGCAGACGGTGGACCCCGCTGCAGAACGCGGCTCGTGCATGCAATACTCGCATAAGGCGGCATCTACGCCAGAGCCGAATGGCGTCGGTTCGACAAATAAGTTGTTGGCGAAGGTTGTAACTGCAGAAGGAGAATGGAAGGCTGAGGAACCGAACGAACAGTGGATTTTGGCACAGCGAAAGAGATATAGAAACCGATTTAGTACTGTGGAGGGCAAGGCGCGTAATAGTGCAGATCAGAAATTTAAAGCGGCAGATATTCGCGTGCCTTTGTTTGTCAATAATGTTGACAAGACTACATCAGAAAATGACATTGTAGATTATATTTATAACAAAACGCAAGTTCGTGTCATCTTACACAAAATAAAATCTAAAGTACCGAGGCAGTACAGCGCATATAAAATGCTTGTACCTAATGCGAAATTAACGCTGTTTCTAGACAACGCCTTATGGCCAGAAGGAGTGGCTGATTTCGCATACATCGGAAAATCTTCAGTGGACGTTACAGCCGGACCACTGAAGGGTCGAAGCCACGGTGGACTTGGAATTTTATGGCGTAGAAATATTTTTCACGCGGTATCGGTGATTGACTGTGTAAACTCACGTATTGCGGCAGTTAAAGTGGCTCTTGATGAACGTGAGTTTCTTGTTTTTTCTGTTTATATGCCGACGGACAGCGCGAATAATCTAGACGAGTTCATAGACTGCCTTGCAGAGATAAATGCTGTTATAGAAACTTGTAGTGTAGATTCTGCGTATATACTGGGTGATTTTAACGCACACCCGGGTTCACTGTTTGGTACGGAACTTCTTGACTTTTGTGTTGAACAAAAATGGACATGCGTTGACGTGGAACGTTTGGGTGTACTTTCAAATTCATACACTTATTTGAGTGACGCGTGGGGAACTACGTCATGGTTAGACCACATAATCACGACTGAGGTCGCTACAAAAAGCGTTAGCAGCGTAAATATAAGATACGAAGTATCGTGGTCTGATCATTTCGCGGTCGAATTGATCTGTGATCTTCAAGTTTTAGTGCCCAAGTTTGTACAACAAGGCTATGTGCCTGATAGTGCTACTTGGGGTGATAGAGATAGGGCCCAGATTAATCAATATTGGGAAGTTTGTTCGGCTAATTTGCGAGATATAGATTTTCCAAACGATATGCAAAAGTGTGGAGATATAGTTTGTAATAACTTAGAACATAGACTGATTATCGATAAAATGTACGATAAAATAGTAAGCACACTTCGTAGTTCTGCTGCGGAATGTTCCACAAGTTATAATTTGAAGCGCAGACGTAAGAGAAATATGTATGTTATGGGTTGGAACAAACATTGTAAAGATGCACATAGGGAGGCTCGGCTTCGATTTCATAATTGGATCGCTCTTGGAAAACCGAAATCTGGTCACGCGTATCAGCAAATGCGGGAAGCACGGAGAACTTTTAAAGACAAAGTAAAGTGGTGCAAAAAGAACCAGACTCAAATTAAAATGGATATACTTGCTACACAACATTCAGCAAAAGATTTTTCGAAATTTTGGAAGGAAACAAATAAGTTGAATCCGAAGCCGAGTGTTCCAGGGAGCGTTGAGGGTATAAGCGACTCCGGTCAGATTGCCAATGCATTTAGGGAACATTTTAGAGTGAAGTCTCCATTGGTAACAGCGAATGCTGGTGCGAGTGATATTCGGCTTGGGGAACCAATTACGCGAATCACGGCGAAACAGGTTGCACGGGTGGTGAGTGACATGAAGCGAGGAAAATCGCCTGGTCATGACTCATTGAGTATTGAGCATCTACAATACGCAGGTGTTCACTTGCCCAGAGTGCTTGCCATGTTGTTCACTTTCTGTGTAGGCCATTCATATTTGCCTAAAGCGATGATGAAGACCGTAGTTGTTCCGATAGTTAAGAATAAAACCGGGGATGTATCCAGTTTAGGTAACTACAGACCTATATCACTCGCAACAGTCATCGCTAAAGTACTGGATGGTATAATTGATATTCAGTTACGAAGACACGTAAAGCTGCATGATGCCCAGTTCGGCTTTCGACCTGGACTCTCGACTGAAACGGCCATACTGAATCTCAAGCATACCGTCCAGTACTACACAGACAGAGGCACTCCTGTATACGCCTGTTTTTTAGACTTATCCAAAGCGTTTGATCTGGTGGCGTATGACAGGTTGTGGCATAAGTTGTCGAATGATACAGACTTGCCTCATGAGTTTGTTTCTCTCTTGAGATACTGGTATGGTAATCAGAGCAACTTTGTGAAGTGGTCGGGGTCGCAGTCGGATATGTATAGGCTGGATTGTGGGGTAAGACAGGGTGGCTTGTCATCGCCAAGCCTTTTTAACCTATACATTGACCGCCTGATTCGTGGGCTCAGCAATTCCAATGTCGGATGTTCCATTGATGGTGTGTGTGTTAATAATATCAGTTATGCTGACGACATGGTGTTGCTGAGCCCATCGATCAGGGCTCTCAGAAAGCTGATTAGGATATGCGAGTGTTATGCGGAGGAACATGGGCTCAGATATAATGCCGTAAAAAGCGAACTGATGGTATTTAAATCAGGCAGAAAAACCTACGAAACTGTCCCATCAGTCATACTCAACGGCAGTGTCCTTAAACAAGTATCACAATTCAAGTATCTGGGTCACTGGGTCACTGAGACGCTTGCAGACGATGTAGACATGGACAGGGAGCGCAGGGCGTTGTCAATCAGGGGTAATATGCTGGCCCGTAGGTTCGCGCGGTGTACTGCAGAGGTGAAAGCTACTCTTTTTAGAGCATACTGCCAGTCTTTCTACACGTGCAGCCTATGGGTTAAGTATACCAAGAAATCTTACAGCACTCTGCGTGTCCAGTATAATAACGCTTTCAGAGCGCTGATGTGGCTGCCGCGTCACTGCGTCCGAGATTAG
Protein
MTTRILKCSNCNIVICEVLAVIQNKIDVMSEDSLVRICSTSFSVEEIENAKSLLFESVTTSKRKRTRRREGRMHRDLFDVISLFKETDPELTPTFVARDLQKLPPVHFDHLDATKLLKDILVIQKKIQTIKESYVTEDNLNEIKNELYNLKSASLVNNNFDIHNTEGHINTKRGGGILTNSYYLDSSPIEPPYCSHAEVSIANHEHERSSATATAAATGLDTGDRRVEFVVGNFSTAALNGNTFAPAQTVDPAAERGSCMQYSHKAASTPEPNGVGSTNKLLAKVVTAEGEWKAEEPNEQWILAQRKRYRNRFSTVEGKARNSADQKFKAADIRVPLFVNNVDKTTSENDIVDYIYNKTQVRVILHKIKSKVPRQYSAYKMLVPNAKLTLFLDNALWPEGVADFAYIGKSSVDVTAGPLKGRSHGGLGILWRRNIFHAVSVIDCVNSRIAAVKVALDEREFLVFSVYMPTDSANNLDEFIDCLAEINAVIETCSVDSAYILGDFNAHPGSLFGTELLDFCVEQKWTCVDVERLGVLSNSYTYLSDAWGTTSWLDHIITTEVATKSVSSVNIRYEVSWSDHFAVELICDLQVLVPKFVQQGYVPDSATWGDRDRAQINQYWEVCSANLRDIDFPNDMQKCGDIVCNNLEHRLIIDKMYDKIVSTLRSSAAECSTSYNLKRRRKRNMYVMGWNKHCKDAHREARLRFHNWIALGKPKSGHAYQQMREARRTFKDKVKWCKKNQTQIKMDILATQHSAKDFSKFWKETNKLNPKPSVPGSVEGISDSGQIANAFREHFRVKSPLVTANAGASDIRLGEPITRITAKQVARVVSDMKRGKSPGHDSLSIEHLQYAGVHLPRVLAMLFTFCVGHSYLPKAMMKTVVVPIVKNKTGDVSSLGNYRPISLATVIAKVLDGIIDIQLRRHVKLHDAQFGFRPGLSTETAILNLKHTVQYYTDRGTPVYACFLDLSKAFDLVAYDRLWHKLSNDTDLPHEFVSLLRYWYGNQSNFVKWSGSQSDMYRLDCGVRQGGLSSPSLFNLYIDRLIRGLSNSNVGCSIDGVCVNNISYADDMVLLSPSIRALRKLIRICECYAEEHGLRYNAVKSELMVFKSGRKTYETVPSVILNGSVLKQVSQFKYLGHWVTETLADDVDMDRERRALSIRGNMLARRFARCTAEVKATLFRAYCQSFYTCSLWVKYTKKSYSTLRVQYNNAFRALMWLPRHCVRD

Summary

Pfam
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
ProteinModelPortal
PDB
5HHL     E-value=3.0727e-05,     Score=118

Ontologies

GO

Topology

Length:
1224
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14916
Exp number, first 60 AAs:
0.02334
Total prob of N-in:
0.00145
outside
1  -  1224
 
 

Population Genetic Test Statistics

Pi
360.023613
Theta
211.385275
Tajima's D
3.338905
CLR
0.047304
CSRT
0.991250437478126
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号