SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02280
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.241
 

Sequence

CDS
ATGGACAACCCTCTGACTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCACGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACCTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCTGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MDNPLTRRSVLEAWSRRLADPSAGLRTVEAVRPVLTDWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150308    PZC71477.1    + More
LBMM01016102    KMQ84557.1    LBMM01005707    KMQ91279.1    LBMM01009501    KMQ88083.1    KZ150386    PZC71062.1    KZ149922    PZC77701.1    LBMM01012027    KMQ86470.1    AB078935    BAC06462.1    LBMM01006538    KMQ90523.1    KZ149896    PZC78733.1    QOIP01000014    RLU15083.1    AB078931    BAC06456.1    AB078930    BAC06454.1    ODYU01006757    SOQ48893.1    QOIP01000004    RLU23632.1    QOIP01000060    RLU14687.1    QOIP01000009    RLU18544.1    KZ149950    PZC76665.1    AB078929    BAC06452.1    KZ149918    PZC77857.1    PZC77700.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01006909    KMQ90209.1    ODYU01009945    SOQ54696.1    LBMM01008861    KMQ88580.1    ODYU01006342    SOQ48109.1    ODYU01005282    SOQ45985.1    LBMM01001564    KMQ96079.1    LBMM01009494    KMQ88097.1    LBMM01006954    KMQ90166.1    LBMM01003679    KMQ93242.1    ODYU01005115    SOQ45661.1    LBMM01003452    KMQ93523.1    LBMM01006022    KMQ91008.1    LBMM01008682    KMQ88705.1    ABLF02006132    LBMM01006996    KMQ90129.1    LBMM01005733    KMQ91252.1    LBMM01006671    KMQ90407.1    QOIP01000007    RLU20280.1    QOIP01000012    RLU16027.1    LBMM01019838    KMQ83439.1    LBMM01012797    KMQ85990.1    LBMM01006662    KMQ90413.1    LBMM01019839    KMQ83438.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01005634    KMQ91349.1    LBMM01006657    KMQ90417.1    LBMM01004505    KMQ92346.1    QOIP01000003    RLU25053.1    QOIP01000002    RLU25407.1    QOIP01000031    RLU14697.1    LBMM01015018    KMQ84954.1    LBMM01008349    KMQ88951.1    CH963857    KRF98317.1    LBMM01006110    KMQ90925.1    QOIP01000010    RLU18098.1    LBMM01002480    KMQ94776.1    LBMM01004152    KMQ92762.1    GGMR01010769    MBY23388.1    AAZX01003808    AAZX01004267    AAZX01010366    GGMR01014195    MBY26814.1    LBMM01015025    KMQ84953.1    GGMR01011974    MBY24593.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00732   GMC_oxred_N
PF00650   CRAL_TRIO
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001251   CRAL-TRIO_dom       
IPR036865   CRAL-TRIO_dom_sf       
IPR036273   CRAL/TRIO_N_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF51905   SSF51905       
SSF52087   SSF52087       
SSF46938   SSF46938       
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4XVM     E-value=0.0323489,     Score=82

Ontologies

Topology

Length:
178
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01378
Exp number, first 60 AAs:
0.00299
Total prob of N-in:
0.20335
outside
1  -  178
 
 

Population Genetic Test Statistics

Pi
21.597544
Theta
23.845352
Tajima's D
-0.288448
CLR
0.86794
CSRT
0.290535473226339
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号