SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02255
Annotation
Gag_polyprotein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.359
 

Sequence

CDS
ATGGTTTTTACGATAAAATTTTTATCCCTACAAAAAACTGAACTGGAATACGAAGTTGCGATAAGAGGTGAGACCCCCGGTGCTACGGTGGCTGATCTTAGGAAACAGATTAGCAAATTAAGTCAATCTTTTCCTTCAGAAGATGTATTATGTTCTCATCTCGAACCCCTAGATGATCTTCAAGCTGTTTTGGACTTGCTGAATAAAGTCAATGCAAGTCTCGAGTCAAGCCCTACTGATAAAAGTACATTATCGCGCATAGAAAATATTTTTCATCACCTTTATCATAGGATCAACAGAATAGTGGTTGATGAAGTAGAGAAGCCGCACTCTGCTTGTAGTAAACTTTTTAAAGAATTCTACGAAAAATTCCAGAAATTAAGCAAAAAGGCAATTGATCCTCTATTAATTGGTGTATCTAGTTCAGCATCTGCTTCTGTACCTGGCATTCAGGCACCAATTAATGTCGCTGTTACTTGTGATAGAGGTGTTACTTCAGAACTGAGTAGGCTGAAGTTCGATGGTAAGTCATGTGTTCGATCTTTTATTCAACGTGTTTACGAATTTAGCGAGGCGCGTAGCATCCCCGACTCAAAACTTCTCTCATCTGCTACAGAAATATTTACAGATGATGCGCTGCATTGGTTCAGGAGTATTAAGGACCAGGTTTCATCTTGGGATGATCTTGTTGTTCTTTTAAAAAAAGGTTTTGATAAAACAGACTATGATTACCGTTTACTTGCTGAGATTCGTGCTAGGACTCAAGGGGAAACGGAAAATATTACGATATACTTAGCTATTCTCTCGGGTATGTTTGCCCGCCTCTTAAAATCACTTTCGGAAGAGGACAAGCTTGAAATAGTATTACATAATATCCGCCCTTGCTATGCAAGCACTCTAGCCTCTGCTACTGAAATATGTAACATTGATCAATTGAGATCCTTGTGCAGGAATTATGAAATTGTTCAGTCTAGGCTCGTCCACTTTCGAGAACCATCTGCAGCGACTTCCGATACCTTGGCACCAGAATTTGCGTACAAATATGCGACCAAGGCGAAATCGACCTACGACTATAAATCTAGCTATAGTTACAACAAACAGTCGTATCAACCATTAAAAATAAACAGGAACACTAATATTAATCAAAAATATCTACACAGTATTGAAGAAAGTCATCACGATGCAAGGGAAAAATTACCCTATTGTCCTAGGTGCCGCAACAATACGCATAGTTTTAGGGACTGCACTAATACGGAAGTTTTGTGTTTTAAGTGTGGTCGCAAGGGAGTTAAGAAACCTGAGTGTTCACATTGTACTGGCAAACAGGCTCCAAAAAAACTAAATTTGCAGAATTGTAGCAAACCATTGTCCCTGGAACATGTAAAGATACACCGTACCAGCCGGGATGAATGGAAGAATTGGTTAAAAACAATTAGTTTATTTTTTAATGGCTACAAGGTTGCTTCAATTCTGCATACAAAACCAACTAACGATAAAAGACCCTATGTTAATATTAAGATACACGATTTGACAGTTTCCGGCCTTTTGGATTCAGGCTCAGCGGTTACTATTTTAGGCAACAATGCTCATAGTGCATTAGTTAGTCGTGGGCTGGAGTTGTGTACTGATGATAAATTGACTATTATTGCGGCTGGTGGACAAAATCTTAGAAGTATAGGCTATATTAATATGCCAGTGCATTTCGAAAACCAGTTCCACATTATTCAGAGTCACGTAGTTCCAGAAGTTCAATCATCGCTTATTTTAGGGATTGACTTTTGTCACACATTTAAAATTTGCCCGAAGTACTTGAGTTCTCTTCATTTCCCCGGCCCTCCATTGGCTAATTTAGATGTTGGTAGCCCAACCAATTTTTTGCGCTCGTATGATTATTTGGACGAATCACAAAAGGCCGTCGTTGACAATATTACCAAGCAGTTTGAAGAAATATCTTTTGAGCGCAAAGGACTTGGACGCACAAACTTAATTACTCACCACATCGACACGGGGAATTCTCCTCCTGTGAGACAGCGCTACTATAGGCTTTCACCAGAGAAACAGAGAATCCTAGTCGAGCAAGTAGACGAAATGCTCCAGCTTGATGTAGTTGAGCCTTGTGAGAGTGCCTGGCAATCCCCGGTATTGCTAGTCACTAAAAAAGATGGTCAGCCGCGGTTCTGCTTAGATAGTAGGAAGCTAAACTCTGTTACAAAACGCGACGCTTATAACTTACCTTACATATCGGAGATATTGGACAACTTGCGAGACGCGCGCTATCTTAGCAGTATTGACTTATCAAAGGCTTTCTGGCAATTACCAATAGCACTCGAAGATAGGGACAAGACGGCATTTTACGTTCCGGGACGAGGGACGTTACGGTTCAAGACTACACCGTTTGGTTTGACCAATGCGCCTTCTACGCAACAGCGGTTAGTCGATTTATTGTTTGGCGACATGGATCACAAGGCGTTCGCATATTTAGATGATGTGATAATAGTAAGTAGCACGTTTGATGAGCATGTTAGTCTTCTTCTTCGCGTGTTAGACAAGCTGCGCCATGCTAATCTAACAATTAATTTAGAAAAGTGTGAATTTTTTCGAAGTAAGCTTAAATATTTAGGCTATGTGGTCGACGCGAATGGTTTGCGGACTGATCCGGATAAAGTTACAGCCATTCTAAATTACCCAACTCCTACATGTCGTAAGGACTTGAAACGGTTCCTAGGCACGGCAACATGGTACCGGAGATTTGTCCCAAACTTTAGCACTATCGCAGGGCCGCTTAATAGGTTGACATCGAACAAAAAAATCAACAACTCCCTTCCAGTGGACAGATGA
Protein
MVFTIKFLSLQKTELEYEVAIRGETPGATVADLRKQISKLSQSFPSEDVLCSHLEPLDDLQAVLDLLNKVNASLESSPTDKSTLSRIENIFHHLYHRINRIVVDEVEKPHSACSKLFKEFYEKFQKLSKKAIDPLLIGVSSSASASVPGIQAPINVAVTCDRGVTSELSRLKFDGKSCVRSFIQRVYEFSEARSIPDSKLLSSATEIFTDDALHWFRSIKDQVSSWDDLVVLLKKGFDKTDYDYRLLAEIRARTQGETENITIYLAILSGMFARLLKSLSEEDKLEIVLHNIRPCYASTLASATEICNIDQLRSLCRNYEIVQSRLVHFREPSAATSDTLAPEFAYKYATKAKSTYDYKSSYSYNKQSYQPLKINRNTNINQKYLHSIEESHHDAREKLPYCPRCRNNTHSFRDCTNTEVLCFKCGRKGVKKPECSHCTGKQAPKKLNLQNCSKPLSLEHVKIHRTSRDEWKNWLKTISLFFNGYKVASILHTKPTNDKRPYVNIKIHDLTVSGLLDSGSAVTILGNNAHSALVSRGLELCTDDKLTIIAAGGQNLRSIGYINMPVHFENQFHIIQSHVVPEVQSSLILGIDFCHTFKICPKYLSSLHFPGPPLANLDVGSPTNFLRSYDYLDESQKAVVDNITKQFEEISFERKGLGRTNLITHHIDTGNSPPVRQRYYRLSPEKQRILVEQVDEMLQLDVVEPCESAWQSPVLLVTKKDGQPRFCLDSRKLNSVTKRDAYNLPYISEILDNLRDARYLSSIDLSKAFWQLPIALEDRDKTAFYVPGRGTLRFKTTPFGLTNAPSTQQRLVDLLFGDMDHKAFAYLDDVIIVSSTFDEHVSLLLRVLDKLRHANLTINLEKCEFFRSKLKYLGYVVDANGLRTDPDKVTAILNYPTPTCRKDLKRFLGTATWYRRFVPNFSTIAGPLNRLTSNKKINNSLPVDR

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF03732   Retrotrans_gag
PF00078   RVT_1
PF00077   RVP
PF17917   RT_RNaseH
PF00665   rve
PF09668   Asp_protease
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR005162   Retrotrans_gag_dom       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR001878   Znf_CCHC       
IPR018061   Retropepsins       
IPR001969   Aspartic_peptidase_AS       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR019103   Peptidase_aspartic_DDI1-type       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=1.75596e-41,     Score=429

Ontologies

Topology

Length:
945
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0141
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00016
outside
1  -  945
 
 

Population Genetic Test Statistics

Pi
308.261226
Theta
171.38767
Tajima's D
2.191215
CLR
21.091237
CSRT
0.910104494775261
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号