SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02245
Annotation
PREDICTED:_uncharacterized_protein_LOC106138993_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.397
 

Sequence

CDS
ATGCCTCCTAAGAAGAATAATGATAATGACGAAAGAGAAGACGTTGAGAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATGGAACAGAGATGGTGGCTTTTATCGATACAGGTAGTGACGCGAACCTTATTATACAATCAGAATTTGAAAAAATTGAAAATAATATCCAAAATTATGACAAGAATTCAGAAGTTCGTCTTACGGGCATTGCTAACAAAGAACTACTTATCAAAGGTGTTTTTACTACTCAGCTACAGATTGATAATGCTGTTACGGATATCAAATTTTACATTGTAGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTAAAGTTTACAAGAAATGGTATTTTAATGGAGAAGATTCCACTTTGTGCTATTGTTGTTGAGAAGGACGAGGTCAAAGAAGACTACAAGAAATTAAAAAAAGGAGATTACAAGAAGTTAGAGAAAGAAGATTATAAGAAGTTAGAGAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAGAATACTGTACAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACCAAAGAAGATGGAAAAAGAAATTATAAGAGAGAATCATAGAAGAGGACGACTAAAAGTTGAAGATTGGGAATGGAGGAGGTCCGATACATACGACTAG
Protein
MPPKKNNDNDEREDVEKKNEEEKIPYKKVLLNGTEMVAFIDTGSDANLIIQSEFEKIENNIQNYDKNSEVRLTGIANKELLIKGVFTTQLQIDNAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGILMEKIPLCAIVVEKDEVKEDYKKLKKGDYKKLEKEDYKKLEKEDCKKLVKVPYQNHLTQNRILYKEKNGSSFIAVPKKMEKEIIRENHRRGRLKVEDWEWRRSDTYD

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
239
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00457
Exp number, first 60 AAs:
0.00239
Total prob of N-in:
0.15942
outside
1  -  239
 
 

Population Genetic Test Statistics

Pi
376.981368
Theta
167.36383
Tajima's D
3.692566
CLR
0.081489
CSRT
0.9966001699915
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号