SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02228
Pre Gene Modal
BGIBMGA005783
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.725
 

Sequence

CDS
ATGCAGTTAAGTCTTGGAGATGAAAACGTGGAAGTGGAAACTTCTCCAGGCCCATCTGGAATTCCACAACGGCCTTCATTGACAGAGCAATTGAAAGTCGCCAAGGTGGCGAGGCTTTTGGATAAAAAGCATGAGAATTTGCTGTCTGCGGACCAAAAAAAGGAGCTGGCCAGGCTGCGCGATGGCAAGCAAGTGGGCAATTTTAAAATGCCAGATGCTCCAGAACCACAAAGAGGAAGAGGAAAGGGAAAGGGGAAGGGCAAAGGAAGGGGCAGTGAAGACTCGCGGATGTGGAGGCCATGCCCACTTTTACCTGGGGTACCAACTGTCCCTCCTCCACGTGTACGTCAGTCGTGGGAATTGCAACAGCAACGCCCGATTGATATCACCGCGGAGCAGGAGGGTGAGGATGATGACATCGAAAGCTATTTTCTTCCAGATATCACCGAGGATGAGGAGATGCGTCCTCCCCTCCTCGAGGATGAGGAGGCCGTTCCTTCTGCAGGGACCCCACCTCAAGCGAAGAAACGCAAGATCCAATTTTCGCCCTCGATGGGGATCATCCAGGCTACTGCATTGCCTCAAAATATCGTGCCAGCAGAGATAGAACTCCTGGGGTTTACACCTTCTTCTACCGGTACTCGAACAGCGCTTGACTCTGGAAGAAGTAATTACAGTATGGATATCGATATAAATATGGAGCGTGACTTCATAGAGCCTGGCGAAGGCAGCGAAGTAGATGAAGGTGATTCGGCGAATATGGTCGGTATGATCGATATTTCTTTGAAACCAAGACGAATCGATGATTTTCCGATGGACTTAGACAGTATTGCTGAACATGAGGTAGTTGAGGTGATACAGGAGCTGGACAATGCTGCCGACGAAGTCCTTCGGAACGTGGTAGGACCGGAAACCGATCTGCTTCATTTTGACTGGCGAGGCGAGCCGGAAAATTTTGAGTCTGTCAGGGAAGCATTTACTGTGCCATCTACTGGACCAACGTTTGATAACGCCGATTTAATTCCCTTAGATGTTTTTTTCAAGATTTGGGATGCAGATATTATTGCTTACATCGTGCGCGAAACCAACCGCTACGGTGCTGAGCTAATAAGGTCGACCATTCCATCCAAGCCAAATTCTAGATTAAGCCGTTGGAAAGACGTCACCAGTGACGAAATCCTACGGTTTTTAGCAGTTTTAATGTTACAGTCACTAGTTATAGATTATGTGGAGCGCGAATATTGGTATGCCGTGATTGAAGAACTCCAAATAGGCAATTTTAAAGAAATAATGACTTATAACCGTTTCATCGTCATCAAACGTTGTCTCCATTTTATAGACAATGCCACTTTGCCCGTGCCGCCTACCAAACTCGATAAAATCATCCCCATCATAGAGCACCTAAACAAAAAATTTAAGTCTTTATACGTACTAGAACAAAATATAGCAATTGACGAGTCACTCCTTCTTTGGAAGGGGCGCCTCTCATTTGCGCAAAAAATTGCTACAAAAAGAGCTCGAGTAGGTATAAAGTCTTACGAGTTATGTGAATCCAGGACTGGATATTTATGGCAGATGGAGGTCTACACGGGCAAAGGGCACGCACATGTGGTACAAGACGGGGAGCCGGAAGAGCGCGGGCAAGAGTCTGACGAGCCGGAGAGTGCCACGGCCCAGATTGTGCTGAACTTAACGAGATCACTTTTTGATAAAGGCCATACATTAATAATGGACAATTTTTATAATGCGCCACTTTTGTCTCGGATCCTAAAAGTTCAGCACAAGACTGATTCGATGGGTACTCTACGACTTAACAGAGAGTTTGTCCCCGAAGCTCTTAAAAAAAAAACAAAAAAAAACATGAAGGAGGGCGAGGTGGCATTCAGCACAACCAAAGACCTCAGTGTGGTTGTGTGGATGGACAAAAATATTGTGGCAATGATTTCTTCTTTCCATCCCATAGAAGTCGGCGGCATTGAAAAATACGGTTATTACCGGTACAAACCGCAAGTTGTTCTTGATTATAATTTCTCAATGGGCGGCATCGACCACAAAGATCAAATGCTGTCTGCCTATCCCATTGAGAGATCACGTAACATAATCTGGTACAAAAAATTATTTCGCCGACTTTTAAATGTATCGATGCATAATGCTCTCGTGATGTTCAACCACAACCGCACTCACGCCCTTCGTCACCGTGAATTCCGCCTGCAGTTGGCAAAGCAACTGCTGCAAAGCAGCAGATCAGCAGCACCTTCCCGGTCTTTAGCACCGGCAGCACGACCAGAACCAGCGGCATGCATACGGGACATGCACTTGCCAGGAAAAAATACAAAAAAACAGCGCTGCAAGCTCTGCTACTCTGCCAAAGTGCAGCGCTCGACGGTGTGGCGGTGTACCACCTGCAATGTCAATCTGTGTATCGTAGGATGCTACACCGTATACCATATCAATCTAGCGCAAACGCCCGCCGTTTAG
Protein
MQLSLGDENVEVETSPGPSGIPQRPSLTEQLKVAKVARLLDKKHENLLSADQKKELARLRDGKQVGNFKMPDAPEPQRGRGKGKGKGKGRGSEDSRMWRPCPLLPGVPTVPPPRVRQSWELQQQRPIDITAEQEGEDDDIESYFLPDITEDEEMRPPLLEDEEAVPSAGTPPQAKKRKIQFSPSMGIIQATALPQNIVPAEIELLGFTPSSTGTRTALDSGRSNYSMDIDINMERDFIEPGEGSEVDEGDSANMVGMIDISLKPRRIDDFPMDLDSIAEHEVVEVIQELDNAADEVLRNVVGPETDLLHFDWRGEPENFESVREAFTVPSTGPTFDNADLIPLDVFFKIWDADIIAYIVRETNRYGAELIRSTIPSKPNSRLSRWKDVTSDEILRFLAVLMLQSLVIDYVEREYWYAVIEELQIGNFKEIMTYNRFIVIKRCLHFIDNATLPVPPTKLDKIIPIIEHLNKKFKSLYVLEQNIAIDESLLLWKGRLSFAQKIATKRARVGIKSYELCESRTGYLWQMEVYTGKGHAHVVQDGEPEERGQESDEPESATAQIVLNLTRSLFDKGHTLIMDNFYNAPLLSRILKVQHKTDSMGTLRLNREFVPEALKKKTKKNMKEGEVAFSTTKDLSVVVWMDKNIVAMISSFHPIEVGGIEKYGYYRYKPQVVLDYNFSMGGIDHKDQMLSAYPIERSRNIIWYKKLFRRLLNVSMHNALVMFNHNRTHALRHREFRLQLAKQLLQSSRSAAPSRSLAPAARPEPAACIRDMHLPGKNTKKQRCKLCYSAKVQRSTVWRCTTCNVNLCIVGCYTVYHINLAQTPAV

Summary

Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       

Ontologies

GO

Topology

Length:
825
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10554
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  825
 
 

Population Genetic Test Statistics

Pi
70.186781
Theta
131.672364
Tajima's D
-1.260209
CLR
1.819245
CSRT
0.0931953402329884
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号