SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02181
Annotation
Transposon_Tf2-9_polyprotein-like_Protein_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 3.036
 

Sequence

CDS
ATGCCGCCGCGAAAAATACGCCAACAGACGGATGACAATAGTGATTCTGGTGATGAAATGGTGGACGCAGTGCCCTCGCCAGCACCAGTGCTCATGTCCGGGGATCAGCTGTCCTCGCTCCTGGCCGCCTTCTCAAAGTCGCAGGCCGAGGCGAACCGACAACTCGTCGAGTCCCTGTGGGCATCGCATGGTTTGGGAAGTGGATCGAAGTTCACCACCCCGATAGTGTCACCGTCCCCGACGCCAACAAGTAACATGGCTAAATGCACCGCGCGTTTTGATGGCGTCGCTCGCGATCCGGAGGCCGTTGAAGCGTTTATCGACTCTGTGGAGGTGTACAAGGAGTGTGCGTGCGTCTCCGACGATATCGCATTGCGTGGACTACCAATGCTCATGGAAGGCGAAGCAGCCATATGGTGGAGAGGGGTCCGGAACGAAGTGTCCTCGTGGCCCGACGCTCTTAAAAGGTTACGAGCTATGTATGGTGTGCCACGCCCTGCACATAAAGTTTTTCGTGACGTGTTTTCGTCTGAGCAAGGTGATGAGCTTGCTGACAGTTTCATAGTGAGGATACGTGCTATGCTGTCCAGATTGCCGTACCAGCTACCAGAGGAAGCCAGGTTAGACATAATCTACGGTCTACTTCATAAACGGATAAGGAAAAGACTACCGAGAGATGGTGTGAGCGACATAGAAACACTCATAGAGAAGTCGCGCATGGTTGAGGAGTCACTTGTGGAGTGCGCGGCTGCCCTCAACATTCCGCCGCAGCCACACAAGTCGTTACCTACGGTGTTCGGCGAACGCAGCTCCGCGCCTGACGTGACAAGTGTGAGATCGCCGAGACCTGCCGGCGCTGCCGCTGCGCTAGTGCGCTCCTCCGTTGCTGTTGCACCGTCGTCGCTACCTCAACCGTCCCCATCCCCGCGTAGTGTGAAAAGCGAAACATTGGTTAAAAAGCTATTTTGTGTGTATTGCAAATCGCGTGGACATGTCCGTGATTCTTGTAACAAAATTAGTGAAAACAAATCTGTATCTTGTTATGGTTGTGGTGAAAAAGGTTTTATTAAAAGTAACTGTCCAAAATGTAACAATATTCCTAGCAATATTCAGAGTAATGTTATTAATAGAAAGTCGCACGTTAAGGACAATGTATTCTATTCTGTAAATGTAAACACTTTCTCAGATTCACATTGTAATGATAAACATTCTGTAAGTCGACCTATATTGCATATAGGTATACAGGGTTATAATGGGACTGCTTTGTTAGATACCGCCGCACGGCGTAGTATCGCGGGTTACACACTCTACGCGCTTTTTCAACGTTTAGGTATGAAGTTTCGCACTGAAAATATGTCGGTGAGACTCGCGGATGGTACCACTCGGAACACTAAGATATTATTAACACATGCAGACGTTGAATTAAGTTCAGTATGTATACCTATTGAGTTTATTATATTCCCCGATTCTCAGAATAATGAAACCTTGTTAGGAATAGATTTTATTTTGAAGGCACGATTAATAATTGATTTCTCTTCTATGACTTGGCGCTCGGCTGATCAGCCTCGGGACATTCACCCTTTGTCATGTGAAAATTCACGTGACCCCATAAGTTGCGCTTCTATAAACTTGTTGCGCGAGGATGAAGGTAAATTCTTATCGGAGTCGGAAAAGGGGCGTCTGGTGGATTTACTAGGTGAATATACTGATGTTTTCGAGGAAGTCGGTGAGCCGACTCCTTTTTCAGAGCATCGGATCGACACCGGCGACCACCCTCCTATCGCTGTTCCTCCGTATCGTGTCACGCCGGCGAGGAAAGAGGTCATGCGCGCCGAGCTCGACAAGATGCTAGCAGAGGACGTGATCGAGGAATGTGAGTCTGCGTGGTCCGCGTCGTGTGTCTTGGTGCCGAAACCTAACGGTACGTATAGGTTTTGTGTTGATTATAGGAAACTGAATGCGGTCACCAAGACCGATTCCTATCCCATGCCTCGAATTGATGAACTTCTTCAGTCTACCAATGGAGGTTGCGTTATGAGCTCGTTGGATCTTCGGAGCGGGTACTGGCAGGTTCAAACCCTGGACAGAGACAAAACTGCTTTTAGTACACCCTTTGGTACCTTTCGTTTTAAGCGTATGCCTTTCGGCTTGAAGAACGCACCGGCAACCTTTCAGAGACTGATTGATCGGTTTCGATCGGGCTCTTCTCTCCAGGAGGTAGCTATCCTGGCGTATCTCGACGATATTTTAGTGATATCAGAAAATATTGATAAACATTTTTCAGATCTCCGTGCGGTGTTTGACCGGCTCCGCGTGTTCAAGCTGCGAGCCAATAGGGACAAATGCGCTTTTGCCCGGGAGCAAGTCAAATACCTTGGTCACGTGATCTCGAGGTCAGGTATATCTCCGGACAGGGACAAGGTAAGCGCTGTGTTGGATATGAAGGAACCTACATGTCTCCGACAACTTCGTACTTTTCTCCAGACGTGCTCGTGGTTTCGTAAATTCATCCCGAACTTTGCGAAGATAGCCGAACCTCTCACACGATTGACCAAAAAGAGTCAGCTTTGGATTTGGGGCCTGGAGCAGGATGATGCCTTCAAATCTCTTAAGAGGCTACTGACGACATCTCCGATTTTGATACAGGCAGACTATACTAAGCCTTTCATCCTTAGGACTGACGCGAGTGATTATGCTCTAGGTGCATGTTTGCTCCAGGGGGAGTCATCCAATGATGAGCGTCCCATTGAGTACGCCAGTCGTCTTCTGACATCGGCGGAGCGCAACTATTCGACGACCGAACGGGAGGCGCTCGCTGTCGTCTGGGCTGTGGAGCGATTCCGAGGCTACATCGATGGACATCTGGTGCACGTTCGTAGTGACCATCAGCCCCTGAAATGGTTGTTTTCAGTAAAGTCACCGAGCGGCAGGTTAGTTCGCTGGGCTATGAAGCTTCAAGCTTACGATTTGCAAATTGAGTACACCCCAGGAAAAGTTAATGTGATAGCCGACACGCTTAGCCGCCCAGTGACCGAGCTCAACTCGCCACCGGACTGTGGAATCTGTCCCGTTATCGTCGACGTGCCCCACTGGGATGCCGCTTCGACCCGGGACGCTCAGATGGCTGATCCGGAAATTTCCAAGATCATCACTGATTTGGAAGGGACCGATGAATTATCTGTTAATAGATGGTCTGAACGAGGCTATCTCCTAACTCAAGGCGTTCTATACCGCTACGCCGAAGATTCTGAGTCCGAGGAACCTCAGCTAGTCGTACCAGAGAGCTTGCGTGGCAAGGTCATGTTCGAGTGTCATGACTCGCCCACAGCCGCTCACGGGGGGATTCAAAGGACCATTCATCGTATCTCCCAACGATTCTATTTTCCAGGTTTGAGACGCTATGTTACTGAGTATTTGAAAACGTGTATAGAGTGCCAGCGGTACAAGCCGTCTAACTTTAAGCCAGCGGGACTACTCCAGACTCCAGTTCCAGCTCAGCGGTTTGAAGTTATTGCAGTAGACCTTTTCGGGCCTTTACCCAAAGGACCCTGCGGTGAGAGGTGGATCCTGATAGTCGAAGACACCGCCAGTAAGTGGGTTGAGCTGTTCGCTCTCATTGATGCCACTGCCGAGGTATGTGCAAAAACCCTCGTTAATGAAGTCTTTATGAGATTCGGAGTGCCTCGCCGGATGATTTCCGACAACGGAGTTCAATTTGTGGCCGATGTCATGCAAAAGGCTATGTTTGTTTTAGGGGTAAAACAAAATCTCATTCCTCTTTATCATCCCGAAGCCAATCCGGTTGAGCGGAAGAATCGGGACTTAAAGGCTCATCTTGCCATATTGCTTGAAAGCCGTCACCAGCAGTGGCCTGAGGTACTGTCGTTCGTCCGATTCGCTTTTAATAGTTCCGTCTGCACGTCAACCGAGCAAACGCCAGCTTATCTTACCTTTGGTCGTGAGCTCCGATCTCCAATATCCGCTCAGCTTGATCTTCGCGCCGTCGTAGAGTCCGAGAACTTTGTTCCCCAGATAAGCCCATATTTGTCCAAGCTTGCCGAGACCATCTCGACCGCTAAGGAGAATATTGAACATCATCAAGATATTCAAAAGACGCGCGCTGATCTAAGGCGCTCTGAACCTTACCAGTTTGCAGAAGGGGATCTCGTATTGATGAAGACCCACGTACTTAGTAATGCTAGTAAGGGTATTACGTCGAAGTTTAATCCTAAGCGGGATGGGCCATATGTGATTTCAAAAAAGGTGAGTCCTACTTCCTACCTTCTAGCATACGAGTCGTCGGGCGAAGTTTTTGGTAAGTATCATGTCTCGGATTTGCGACCTTATCATGCGAGGGAGGATGTATGTCCCGAGCCTGTGATTCCCAAGCGCCGCCGGGGTCGACCGCGTAGAGTGGTGGAATAG
Protein
MPPRKIRQQTDDNSDSGDEMVDAVPSPAPVLMSGDQLSSLLAAFSKSQAEANRQLVESLWASHGLGSGSKFTTPIVSPSPTPTSNMAKCTARFDGVARDPEAVEAFIDSVEVYKECACVSDDIALRGLPMLMEGEAAIWWRGVRNEVSSWPDALKRLRAMYGVPRPAHKVFRDVFSSEQGDELADSFIVRIRAMLSRLPYQLPEEARLDIIYGLLHKRIRKRLPRDGVSDIETLIEKSRMVEESLVECAAALNIPPQPHKSLPTVFGERSSAPDVTSVRSPRPAGAAAALVRSSVAVAPSSLPQPSPSPRSVKSETLVKKLFCVYCKSRGHVRDSCNKISENKSVSCYGCGEKGFIKSNCPKCNNIPSNIQSNVINRKSHVKDNVFYSVNVNTFSDSHCNDKHSVSRPILHIGIQGYNGTALLDTAARRSIAGYTLYALFQRLGMKFRTENMSVRLADGTTRNTKILLTHADVELSSVCIPIEFIIFPDSQNNETLLGIDFILKARLIIDFSSMTWRSADQPRDIHPLSCENSRDPISCASINLLREDEGKFLSESEKGRLVDLLGEYTDVFEEVGEPTPFSEHRIDTGDHPPIAVPPYRVTPARKEVMRAELDKMLAEDVIEECESAWSASCVLVPKPNGTYRFCVDYRKLNAVTKTDSYPMPRIDELLQSTNGGCVMSSLDLRSGYWQVQTLDRDKTAFSTPFGTFRFKRMPFGLKNAPATFQRLIDRFRSGSSLQEVAILAYLDDILVISENIDKHFSDLRAVFDRLRVFKLRANRDKCAFAREQVKYLGHVISRSGISPDRDKVSAVLDMKEPTCLRQLRTFLQTCSWFRKFIPNFAKIAEPLTRLTKKSQLWIWGLEQDDAFKSLKRLLTTSPILIQADYTKPFILRTDASDYALGACLLQGESSNDERPIEYASRLLTSAERNYSTTEREALAVVWAVERFRGYIDGHLVHVRSDHQPLKWLFSVKSPSGRLVRWAMKLQAYDLQIEYTPGKVNVIADTLSRPVTELNSPPDCGICPVIVDVPHWDAASTRDAQMADPEISKIITDLEGTDELSVNRWSERGYLLTQGVLYRYAEDSESEEPQLVVPESLRGKVMFECHDSPTAAHGGIQRTIHRISQRFYFPGLRRYVTEYLKTCIECQRYKPSNFKPAGLLQTPVPAQRFEVIAVDLFGPLPKGPCGERWILIVEDTASKWVELFALIDATAEVCAKTLVNEVFMRFGVPRRMISDNGVQFVADVMQKAMFVLGVKQNLIPLYHPEANPVERKNRDLKAHLAILLESRHQQWPEVLSFVRFAFNSSVCTSTEQTPAYLTFGRELRSPISAQLDLRAVVESENFVPQISPYLSKLAETISTAKENIEHHQDIQKTRADLRRSEPYQFAEGDLVLMKTHVLSNASKGITSKFNPKRDGPYVISKKVSPTSYLLAYESSGEVFGKYHVSDLRPYHAREDVCPEPVIPKRRRGRPRRVVE

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
PF17919   RT_RNaseH_2
PF03732   Retrotrans_gag
PF00077   RVP
PF00098   zf-CCHC
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=6.46208e-73,     Score=702

Ontologies

Topology

Length:
1474
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00411
Exp number, first 60 AAs:
0.00048
Total prob of N-in:
0.00018
outside
1  -  1474
 
 

Population Genetic Test Statistics

Pi
399.956155
Theta
204.735392
Tajima's D
3.410718
CLR
1.869275
CSRT
0.991950402479876
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号