SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02180
Pre Gene Modal
BGIBMGA001112
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.507 Nuclear   Reliability : 1.371
 

Sequence

CDS
ATGGATTCAAAATTCAAGCCAGGCAGCAGCTACCGGAAAAGGCTCCGGGAGGGAGCGGCTATGGTTAGGACAAAGTTGATCCCCACCATGTCCAAACTCGTCGCGCAGCTGGACTCTATGGAGAGTCGCATTCTGAGGAACTCCCCCGTCTTGCAAGAGGGGACTCCCTTGTCGCCGATGCCTGCGCTGGCACACTCTGGGCCTCCCGCGAGGAAGATGGATACCAGCGTGCCCTCACGACCCGTGATGAGTGTGGCGGCGCCCATGCCAGCGCCTACTTCTGTGGCCCCTGTTCCACGAGTGCCTACTCCCGCGCTCCCTCACCCCCCACGGAGGGTTGAGTTGAGGCCTGCGCCGCCTCCCCAAATATCGGCCACCCCTGCATCCGTACAAAGAGGAAGATTAAGGCCTGCGCCAGCGCAGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGATAGACGAGTGGCCGGCGCTGCCGCGGCCCAGGCCTGCAGAGCCGCCAAGCAGAGAGGAAATGGCGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCCGCAAACACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCGATTGGTTCCGGAGATGGCGTCCCGGCACCAACAGCCACGACCGCTTTACGGGATCAGGCCGCCCAGCCGACTTCCACTCCTGCCCCATCCGCAAGGGTGGCACGACGTGGAGGCCGGAATATCAGAGGTGCGGGTGCCCAGAATCCCGGCCCGCGATCCCAACCACAGCCTCGCCCCCTTCCTCCGCCCCCGTTAAGCATGGACGAGGGCTGGACAGAAGTGGTGAAGCGGGGCACCACAGCACGGCGACAGATAGCAGCTCTGGCAGCTCCCCGAGGGGGTCGAGCGCCGACCGCTACATCCCGAAACACAGCGCTGGCGGCCGTGACTGCTCCCCGCGAGGGTCGAGCACCGGCCGTTGGCAAAAAGAAAAACAAAAGGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTGGTAGTGACTTTGCTGCCGGCCGCTGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGTGCAGCTGTAAACTTGACCGAAATCGGGGCAGAGGAAGGTCTACGCTTCCGGCACACCGCCAATGGGGCGAAAATGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCATTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAGGAAGAGGTGGCAGCCGCGATAGCCGCCCAGGGGGGATGTGCTCCGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGATCGGCGTGGGCGCGCTGCCCTGTGGAGGCGGCCACTTCCTTGGCCACCCCTCCACCGGGAAGATCGACGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGATGTTTTAGCACGGGGCACGGCCTCGCTAGGTGCACCAGCTCGGTTGACCGCAGTGGTCTTTGTTTCCGTTGCGGCCAGCCGGGCCACAAAGCAGCGTCCTGCACGGCCACCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGAGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAACAACACCGAACGAAACCGGCGCCGGAGATCAAAGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGTTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCAGTGAAAGGGAGGGGGCGATGGATGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGGGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGAAGCTGGAAGGGACCGTCGTGATCGGGGCATACTTCTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTAAATGCGAAATCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAAGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACACTGTCCGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCACAGGGATTACCCACGTGGTGCGCCCCGGTCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGCGCTACTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACATCCGGTTGAGGTCGAGGGCGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGCGACGTATCGATGCCCCGGATCAGCCCTCGGTCTCCCAATCGCCAGGCGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCTAGGCATCGCCGCCGTCGCCTGCCGCGTCGCAACGATCCGGTTGCGTTCGCGCTGGTGGAGGCCCGGCTGTACGGCGCATTTCGCGTCGCGCAGAGGGCTTTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCTTGGAGACGCTCGATGGGGATCCGTGGGGGCGACCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGAAATCGTCTCGGCGCTGTTTCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACCCCCCGTCAGAATACGACGGCGACGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCATGTGGCAGTGCGTAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCTATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCATGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGTCCCTCTCGGATGAGGCCGTCTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTATCCGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATAGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGGCTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCAAGAGAGCTACAACAAACAAAATGATAAGGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGATCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAATGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAAGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGGTAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MDSKFKPGSSYRKRLREGAAMVRTKLIPTMSKLVAQLDSMESRILRNSPVLQEGTPLSPMPALAHSGPPARKMDTSVPSRPVMSVAAPMPAPTSVAPVPRVPTPALPHPPRRVELRPAPPPQISATPASVQRGRLRPAPAQAEDIRSPLARMIDEWPALPRPRPAEPPSREEMAACISRAVAVEVRKHFAGLEEMLRSSIGSGDGVPAPTATTALRDQAAQPTSTPAPSARVARRGGRNIRGAGAQNPGPRSQPQPRPLPPPPLSMDEGWTEVVKRGTTARRQIAALAAPRGGRAPTATSRNTALAAVTAPREGRAPAVGKKKNKRKKPRAAGSAAVVVTLLPAAAEKGLTYNEVMARARAAVNLTEIGAEEGLRFRHTANGAKMLECPGADSSGIADKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTATPHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRRSKRRQKRRLARGALANAVIPVAAPVPEGGGSSEREGAMDDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVKLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADAHRDYPRGAPRSFPRWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRISPRSPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFALVEARLYGAFRVAQRALQLAIRRAKDQHMEGLLETLDGDPWGRPYHMVRNKMRPWAPPITERLQPQQLREIVSALFPQEREGFVAPAMDPPSEYDGDVPAEVPHITGAELHVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVMVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRIRGVARPSPSVVRARRAQSRRSVLEAWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHSCFGEFLHRIGAEPTAECHHCGCGLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRKRATTNKMIRYAHSSEEASNRIPRVQRDHFPSSLMVWLGVSYWGLTEVHFCENGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAVDDWPRRLKACIQNHGGHFE

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=5.05041e-11,     Score=169

Ontologies

Topology

Length:
1806
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17499
Exp number, first 60 AAs:
0.00353
Total prob of N-in:
0.00202
outside
1  -  1806
 
 

Population Genetic Test Statistics

Pi
295.164136
Theta
175.758855
Tajima's D
0.705333
CLR
149.944285
CSRT
0.574621268936553
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号