SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02083
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.558
 

Sequence

CDS
ATGATGGCAAATTGTGAAAAGTTTGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCTCAGTGGAAGCACGCTGCCCCACGTACTCTGGGGGGGGCAACAATTGTCAGGATGAAGGGGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGCGCTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGCAATCAATCCCACCAGACCATCGGCGGGGAAAAAGAGGGGGAGAAGAAAGACGGCATTACCAACTTCCGATGACGGCGGCGCGTCATCCTCCGGCACTGAGGTACCGGAAAAAACGATGGCCATCGAGGAGGTGACTCCGGTAGTTTCGGTGCCTGCTACGTCGGAAGACGCGATGCCCGCTCCCCAGTGGGCACCAGTGAGGAGGAGGGGCGCTGTGTCACCGGCGACGTCCGTGGAGTCCATGTCGTCGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCATTGGTCAATTTGGGTAAGTTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGTTACCGGAAACGGCTCCGGGAGGCAGCCGCTATGGTGAGAACGAGGCTGATCCCCACCATGTCCAAGCTTTATGACTTGGTAGAGAGCCGGGAGGTGGGGAGCAAGGATCTCGTCGCTCATTGTGACTCCAGCGAGAGTCGCATCCCGGGAGACACCCCGGCCTTGCGAGGAGGGACTCCCTTGTTGCCGAGGCCTCCACTGGCACGCTCTGGGCCCCCCGCGGGGGCGATGGATACTGACGTGCACTTGCGGTCGGCGGTGGGTGTGACAGCGCAAATGCCAGAGCCCAATCCTGTGGTCCCTGTCCCGCTAGCACCTACCCCCGCGCTCCCTCGCCCTCCACGAAGGGTTGAGTTAAGGCCTGCGCCGCCTCCGCGGATATCGGCCGCCCCTGCGTCTGCACGGAGAGGAAGGCTAAGCCCTGCGCCAGCGCGGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCGGCGCTACCGCCGCCTCTTTCACCCTCGCGTGCTGCGGGATTGCAGGCTCGCGGGCCACACAACACGGCTGCTGGGATAGAAGAGGTGGACTACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGTATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATACTCCGCTCTTTGATTGGTTCCGGAGATAGCGTCCCGGCGCCAACAACCGCAGCCGCCCCGCGGGGCCAGGCTGCCCGGCCGACCTCTACCCCCACGCCATCCGCGAGGTTGGCCCGGCGTAGAGGCCGGGACCAGAATAACAAGGGTACGGGTGCCCAGAATCCTGCCCCGAAATCCCAACCCCGTCCCCTTCCTGCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGCAAAGCAGCAGACAGCGGCTCTGGCAGCTCCCAGAGGGGGTCGAGTGCCAACTGCGGCAGCCCGAAGCACAGAGCTGGCGGCCATGGTTGCTCCTCGTGAGAGTCGAGCACTGGCAACCAGGAAGCAGAACGGCAAAAAGAAGAAGCCGCGCGCAACGCGGTCGGCTGCCGTCGTAGTGACGTTGCTACCGGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGAGCGCGCGCGGCTGTAAGTTTGGACGAAATCGGGGCGGAGGAGGGCCTCCGCTTCCGGCATACAGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCAGACAAACTAGTGGCGACGCTCCGCGTGGCACTGCCGGAGGAGGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGAATCACCGGCCTGGACGACTGTGCTACCAAGGAGGAGGTGGCAGCCGCAATAGCCGCCCAAGGTGGATGTGCCCTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCTGGAGCCAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCGCCAGGAAGATCGATGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGTCTCCGATGCTTTAGCAGCGGGCACGGCCTCGCTAGGTGCACTAGCTCGGTTGACCGTAGCGGTCTGTGTTTCCGCTGCGGCCAACCGGGCCATAAAGCGGCGTCCTGCACAGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGCCGAAAATCAAAGCGCCGACAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGATGCGGCGCCGGCGCCGGTGGGCGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGTGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAACTGGAAGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTAAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGTTCCGCAGTCGCGGACGTCCACGGGGACTACCCCCGTGGTGCGTCCCGGTCATTCCCCAAATGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGATGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGACGCAATGATCCGGTTGCATTCGCGGCGGAAGAGGTCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTACGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTATCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGTGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTAAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAAGGACGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGACGGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCAATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAAGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGTAGTTTTGGCGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTTCGTGCTCACTTTCAGAGCCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGACGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGGGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANCEKFVPQEGTARESGGESLRASSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPRRSPIAGSMRSALASDSGAINPTRPSAGKKRGRRKTALPTSDDGGASSSGTEVPEKTMAIEEVTPVVSVPATSEDAMPAPQWAPVRRRGAVSPATSVESMSSSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVRTRLIPTMSKLYDLVESREVGSKDLVAHCDSSESRIPGDTPALRGGTPLLPRPPLARSGPPAGAMDTDVHLRSAVGVTAQMPEPNPVVPVPLAPTPALPRPPRRVELRPAPPPRISAAPASARRGRLSPAPARAEDIRSPLARMVDEWPALPPPLSPSRAAGLQARGPHNTAAGIEEVDYSLPSREEMVACISRAVAVEVGKHFAGLEEILRSLIGSGDSVPAPTTAAAPRGQAARPTSTPTPSARLARRRGRDQNNKGTGAQNPAPKSQPRPLPAPPSSMDEGWTEVVKRGKKAKQQTAALAAPRGGRVPTAAARSTELAAMVAPRESRALATRKQNGKKKKPRATRSAAVVVTLLPAAAEKGLTYNEVMARARAAVSLDEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSMGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSSGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGDNTERNRRRKSKRRQKRRLARGALANAVIPDAAPAPVGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDYPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAEEVRLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFIAPAMDAPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILTARIIQHLVRVGPNLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIRGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFGESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQSLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARDVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.10935e-10,     Score=167

Ontologies

Topology

Length:
1897
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0943
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1897
 
 

Population Genetic Test Statistics

Pi
224.328995
Theta
162.578669
Tajima's D
0.507434
CLR
0.920695
CSRT
0.511624418779061
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号