SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02072
Pre Gene Modal
BGIBMGA009030
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like?_partial_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.071
 

Sequence

CDS
ATGGCAAAGTGTGGAGCATGTGGAAAATTCTTGTCAACCGCGGACTGTGCGCGTTGTAGTAAATGCAGTGACATCTTCCATAAAGGATGCGTGTCAATCCCATCTACGGGCGCTGCGCCTCGGGGCTGGATCTGCCCTAGTTGCTCAGCGAAAGTACCTCGTGGGGATAATACGGCAACTCCTGTACGAGGGTTGACAGCTGTCGGGGTGCATCACACTTCGAGCGAGGGAGATGTTGATGCAGATACGATGAATCGGTCGCTGGAGTCTCGTGTCGACCTTGGTTTAGAAATCCGATCTTTTAAGGATGAGCTGGTGGGCCTAAGAACTGACTTGAGAGAGTGCCGAAATGATATCGCTGAGTTTAAGGAGCTCCTCAAGTCTTGTCATGGACGCATCGACACGGTGGAAGCCCGAGTGCTTGGTCTTGAGGCTCGTCTAGCAGAGATCGTCTCAACAGCAGCAGGTTCTGACTTGGATTCCACGGTGGCTGAACTTCGCATTCAGCTGCGTGAACGCGATCAGGACTTGCTCAGGAATGATATTGACATCATTGGTTTGCCGGAAGTTCGTGAAGAAAGCACTTGTCATTTAGTCCAGGTTGTGGCGGTAAAACTGGGAGTGAAACTTGACATGCGCGACATAGTTCACGCGGAGCGGATTGGTGCAGTAAGACGCAATTTCATTGAGGGCAACGACAATCGTCCTCGTATACTATCAGTACGACTGGCCCGTCGCTCGGTTCGCGATGCACTATTGAAGGGAGCCCGCGTGCGCCGTAACCTCTCCACTACTGATTTAGATGTACCTGGCCCCGTCCGTACTGTATATTTAAATGAACGTTTGTCCGCATATAACCGCAAGCTGTTTGGTACTACCCGTCAAAAGGGAAAGGATAAAGGTTGGAAGTATGTCTGGACCAAGGACGGACGAATTTATATTCGTCGTGGTGATGGTACTCCTGCGCTCAGAATCAGAGTTCAGGCCGACGTGGAGAAGTTTGGGGAGGAGGGCCGTGCACCTTGTGTGCCAGGCTACAGGCTCAAGCATATTCCTCGACCAGTTAGTATAAGGGGTGGTCGTGGTGGCGGGGTGGCCTTTTATCTCAGAGCTGATATAAGTGCTCGAGTGTGTAAGCACCCCGGACATTTGGATGTTGAACAGTTGTGGATAACAGTGAATTTTTGCGGGAAAAAGCTATTAATAGGCACTGCATATCGCCCCCCTTGGTCTGATCTGGAAAATTTCCTAGAGGGATTGACCGAAAGTATTGGTGCTATGGCTCCTTATGACAATATAGTGCTTCTCGGAGATTTTAATGTAAACCTATTGGACTGTAATTGTTCTAGAACAAAAAAAATAAATGAATTTCTAAGCCACTTCAGTCTCTCGCAAATAGTAAGGACTGCAACACACTTTATGAGTGGTAGTAGTACTTTGTTGGATGTTATTTGTACTGACATTGGCGTTAATGATGTCGGGGTTGATTATATTCCCGAGCTTGGCCACCATGCTTTTGTCACATGTGAGACTTTGATCCGAAAGGAAAGACCAATGTCTAGAATGATAACTTCCCGTCAATTTAAAAATATCTTAGAGGAGTTCTTTACTCAGGATCTAAATATAATACCCTGGTCGAACATCACCCTCCTGGATGACGTTGACACGATGGTTTACACCTTTTCTATGTTTATTCTGTACCTGTACGATCTCCATGCTCCGCTCAAAACCCTGAAATTCAAAACACGTTCCACTCCTTGGATTACTGATAATGTCCGATTATTGTTTAAATTGCGAGATGCTGCACGCTATAGATCACATGTAACTCAGGTTCATAGTCATAAGCAGTATTATTTAGACCTTAAGAAGCAGGCAGCTAGCGTCTTAGCATCGGAAAAAAAGACCTACTACAACAATTATATTAATAGCAACTTCGGAAACCCTAAAAAGTTATGGAAAAATCTGAAATCTGATGTGATTCCGTCACATCAGGAGAAAGCATTGCCTGAACACCTTAATGACGCTAATGCTATCAATGAAGCTTTTCTGGATGTACCCGGGGTCTGTAGTTCTGACGTTTCAGGATACTCATTCTTTGAGTATTCTAACACATCTCCAAAGTTTACGCTTAAAACTGTCAACCAGGATACGGTTCTTAAGATTATTAACAGCATTAAATCCAACGCTCAAGGCACTGACGGGATAAGCGGTGAGATGATATCGCTCTCACTGCCTTCAACATTGGAGGCGATTACTAGCATTATCAATAAGTCCATTGATACAAATACATTTCCTGCTCAGTGGCGATGTTCTGTGGTTAGCCCTATTCCGAAAGTCACGCACCCTCAAGCTTTTAAAGATCTTAGGCCTATTAGTGTGTTGCCTTTTCTGTCCAAGATCTTGGAGAAGGTAGTTTACTCACAGGTAGCGGCATATATCGAATCAAATAACATTCTTCCAGAGTTTCAATCGGGTTTCAGAAAAAGCCGAGGAACGGCCGCTGCTCTTACTGACATTGTGGGTAATATTCTCGAGGCTCGGGACAGGAGCCAGGGTACGATACTGACGCTGCTGGATTTCTCACGGGCTTTTGATACAATTAACACTGCCTTACTCTTAGCAAAATTAACTCACTACGGGTTCTCTGATAATGCTGTGGAATGGTTTAGCAGTTATATGTCGAGTAGAACGCAATTTGTACAAATACGGAAAGAAGATGGAACTAAACTAACCTCTACTTCTAAGCCGATTACTAGAGGCGTTCCCCAAGGTTCTGTCCTGGGACCATTGTTGTTTATTTTGTACAGTGCAGATATCATTCAGTGTTTCAAGAATTGTAAATATCATGTTTATGCTGACGATGTACAATTATACCATTCTTTTGATGTTGGAGATACCCCTTCTGCTGTCAGTTTTATCAATGAGGATCTGCAGAGGATTGTCTCTTGGTCTGAACAGAATTCCTTAGTACTGAACCCCTCTAAGTCTAAATACATGATACTAGGCAGTAAATCTCAGATAGCAAAGATTTTATCACTCGATCCTAAGACTGAAGATTCTGTACTCGTTTAG
Protein
MAKCGACGKFLSTADCARCSKCSDIFHKGCVSIPSTGAAPRGWICPSCSAKVPRGDNTATPVRGLTAVGVHHTSSEGDVDADTMNRSLESRVDLGLEIRSFKDELVGLRTDLRECRNDIAEFKELLKSCHGRIDTVEARVLGLEARLAEIVSTAAGSDLDSTVAELRIQLRERDQDLLRNDIDIIGLPEVREESTCHLVQVVAVKLGVKLDMRDIVHAERIGAVRRNFIEGNDNRPRILSVRLARRSVRDALLKGARVRRNLSTTDLDVPGPVRTVYLNERLSAYNRKLFGTTRQKGKDKGWKYVWTKDGRIYIRRGDGTPALRIRVQADVEKFGEEGRAPCVPGYRLKHIPRPVSIRGGRGGGVAFYLRADISARVCKHPGHLDVEQLWITVNFCGKKLLIGTAYRPPWSDLENFLEGLTESIGAMAPYDNIVLLGDFNVNLLDCNCSRTKKINEFLSHFSLSQIVRTATHFMSGSSTLLDVICTDIGVNDVGVDYIPELGHHAFVTCETLIRKERPMSRMITSRQFKNILEEFFTQDLNIIPWSNITLLDDVDTMVYTFSMFILYLYDLHAPLKTLKFKTRSTPWITDNVRLLFKLRDAARYRSHVTQVHSHKQYYLDLKKQAASVLASEKKTYYNNYINSNFGNPKKLWKNLKSDVIPSHQEKALPEHLNDANAINEAFLDVPGVCSSDVSGYSFFEYSNTSPKFTLKTVNQDTVLKIINSIKSNAQGTDGISGEMISLSLPSTLEAITSIINKSIDTNTFPAQWRCSVVSPIPKVTHPQAFKDLRPISVLPFLSKILEKVVYSQVAAYIESNNILPEFQSGFRKSRGTAAALTDIVGNILEARDRSQGTILTLLDFSRAFDTINTALLLAKLTHYGFSDNAVEWFSSYMSSRTQFVQIRKEDGTKLTSTSKPITRGVPQGSVLGPLLFILYSADIIQCFKNCKYHVYADDVQLYHSFDVGDTPSAVSFINEDLQRIVSWSEQNSLVLNPSKSKYMILGSKSQIAKILSLDPKTEDSVLV

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000121728,     Score=112

Ontologies

Topology

Length:
1023
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18928
Exp number, first 60 AAs:
0.00059
Total prob of N-in:
0.00013
outside
1  -  1023
 
 

Population Genetic Test Statistics

Pi
145.26718
Theta
157.917475
Tajima's D
-1.308711
CLR
273.134331
CSRT
0.0885955702214889
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号