SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02052  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003199
Annotation
PREDICTED:_aromatic-L-amino-acid_decarboxylase_isoform_X1_[Bombyx_mori]
Full name
Aromatic-L-amino-acid decarboxylase      
Alternative Name
DOPA decarboxylase
Location in the cell
Cytoplasmic   Reliability : 2.831
 

Sequence

CDS
ATGGAGGCCCCTGACTTCAAAGAATTTGCAAAAGCAATGACTGATTACATTGCTGAGTACTTGGAAAATATTCGTGACAGACAAGTTGTTCCGTCAGTAAAACCTGGCTACCTTCGACCATTAGTTCCGGAACAAGCACCGCAACAACCGGAGCCTTGGACTGCTGTGATGGCGGATATCGAGCGCGTGGTTATGTCCGGGGTCACCCACTGGCACTCGCCTCGGTTCCACGCCTACTTCCCAACCGCTAACTCGTATCCCGCTATAGTAGCAGACATGCTCAGCGGCGCCATCGCTTGCATTGGTTTTACTTGGATTGCTAGCCCGGCATGTACAGAGTTGGAAGTGGTTATGTTGGATTGGTTGGGTCAAATGCTTGGCCTGCCAGAAGAGTTCTTGGCGCGATCAGGTGGCGAGGCCGGCGGTGTAATCCAGGGCACGGCTAGCGAAGCTACTCTTGTCGCACTGCTAGGAGCCAAGTCTCGCATGATGCAAAGAGTCAAGGAACAACACCCTGAATGGAGTGACACCGATATATTATCCAAGCTCGTCGGCTATTGTAATAAACAAGCCCATTCTTCGGTGGAGCGAGCTGGACTCCTCGGCGGTGTTAGGCTAAAATCACTACAGCCAGACGGTCAACGTCGTCTTCGCGGAGACACTCTTCGTGACGCTATTGATGAAGACATCCGCAACGGTCTCATTCCATTCTATGTTGTTGCTACATTGGGTACAACTTCATCCTGCACATTCGACGCTCTTGACGAAATTGGAGATGTCTGTCTCTCACATGGAATTTGGCTTCACGTCGATGCCGCCTACGCTGGATCTGCTTTCATCTGCCCTGAGTATCGATACCTTATGAAAGGCGTTGAGAAAGCGGATTCATTTAATTTCAATCCTCACAAATGGATGCTGGTCAATTTTGATTGTTCAGCAATGTGGTTGAAACAGCCACGATGGATCGTCGATGCTTTCAACGTTGATCCTCTTTACTTGAAACACGACCAGCAAGGCTCAGCGCCAGATTACCGTCATTGGCAAATACCGTTGGGCCGCAGATTCAGAGCGCTGAAGTTGTGGTTCGTTTTGCGATTATACGGTGTTGAGAACTTACAAAAACACATCAGAAAACAGATCGCATTGGCCCATCTGTTCGAGAAGCTTTGCACTTCAGATGATAGATTCGAGTTGTTTGAAGAAGTCACTATGGGTTTAGTGTGTTTCAAACTGAAAGGAAGCAATGAAATCAATGAAGAACTATTACGCCGTATAAACGGACGTGGAAAAATTCATCTTGTCCCATCTAAGATCGATGATGTCTATTTCTTGAGATTGGCTATTTGCTCGCGTTTCTCCGAAGAAAGCGATATACATATTTCTTGGGAAGAAATAAAATCGAGTGCTGACGAAGTTCTTAAAAGCCAAAAGAAGTAA
Protein
MEAPDFKEFAKAMTDYIAEYLENIRDRQVVPSVKPGYLRPLVPEQAPQQPEPWTAVMADIERVVMSGVTHWHSPRFHAYFPTANSYPAIVADMLSGAIACIGFTWIASPACTELEVVMLDWLGQMLGLPEEFLARSGGEAGGVIQGTASEATLVALLGAKSRMMQRVKEQHPEWSDTDILSKLVGYCNKQAHSSVERAGLLGGVRLKSLQPDGQRRLRGDTLRDAIDEDIRNGLIPFYVVATLGTTSSCTFDALDEIGDVCLSHGIWLHVDAAYAGSAFICPEYRYLMKGVEKADSFNFNPHKWMLVNFDCSAMWLKQPRWIVDAFNVDPLYLKHDQQGSAPDYRHWQIPLGRRFRALKLWFVLRLYGVENLQKHIRKQIALAHLFEKLCTSDDRFELFEEVTMGLVCFKLKGSNEINEELLRRINGRGKIHLVPSKIDDVYFLRLAICSRFSEESDIHISWEEIKSSADEVLKSQKK

Summary

Catalytic Activity
H(+) + L-dopa = CO2 + dopamine
5-hydroxy-L-tryptophan + H(+) = CO2 + serotonin
Cofactor
pyridoxal 5'-phosphate
Subunit
Homodimer.
Similarity
Belongs to the group II decarboxylase family.
Keywords
Catecholamine biosynthesis   Decarboxylase   Lyase   Pyridoxal phosphate  
Feature
chain  Aromatic-L-amino-acid decarboxylase
EC Number
4.1.1.28
EMBL
AY461438    AAR23825.1    BABH01010549    BABH01010550    BABH01010551    AF372836    + More
AAK48988.1    AY461437    AAR23824.1    AB072300    BAB68549.1    NWSH01005338    PCG64282.1    KQ461196    KPJ06511.1    JF795469    JF795470    AFG25780.1    AFG25781.1    AB525738    BAJ07588.1    AB178007    BAE43825.2    ODYU01011530    SOQ57325.1    AB525744    BAJ07594.1    JTDY01000586    KOB76562.1    KQ459601    KPI93750.1    AB072191    BAB68545.1    EU032793    ABW39060.1    EU032792    ABW39059.1    KP657625    AKL78850.1    U03909    KF620492    AHB23865.1    AGBW02014799    OWR41040.1    KT428965    ALN66634.2    MF319734    ASJ26448.1    GU953217    ADF43201.1    GU386338    ADU32894.1    AB605615    BAK09608.1    EU032882    ABW39149.1    JQ786184    AGB87994.1    EU032810    ABW39077.1    EU032856    ABW39123.1    EU032848    ABW39115.1    EU032783    ABW39050.1    EU032832    ABW39099.1    EU032835    ABW39102.1    EU032794    ABW39061.1    EU032861    ABW39128.1    EU032851    ABW39118.1    GQ292795    ADH04300.1    JQ785943    AGB87753.1    JQ786119    AGB87929.1    EU032872    ABW39139.1    JQ786061    AGB87871.1    JQ785682    AGB87492.1    EU032839    ABW39106.1    EU032843    ABW39110.1    JQ785832    AGB87642.1    JQ786077    AGB87887.1    JQ785920    AGB87730.1    JQ785789    AGB87599.1    GQ283615    ACT87681.1    JQ786026    AGB87836.1    EU032877    ABW39144.1    EU032778    ABW39045.1    EU032837    ABW39104.1    GQ283612    ACT87678.1    JQ785988    AGB87798.1    JQ785969    AGB87779.1    EU479128    ACD01558.1    JQ785674    AGB87484.1    JQ785890    AGB87700.1    EU032813    ABW39080.1    GQ283647    ACT87713.1    JQ786030    AGB87840.1    JQ786104    AGB87914.1    GQ283652    ACT87718.1    JQ786120    AGB87930.1    JQ786150    AGB87960.1    JQ785894    AGB87704.1    JQ786174    AGB87984.1    JQ785928    AGB87738.1    GQ283616    ACT87682.1    JQ785879    AGB87689.1    JQ785839    AGB87649.1    JQ785770    AGB87580.1    GQ283593    ACT87659.1    JQ786005    AGB87815.1    EU479191    ACD01621.1    GQ283663    ACT87729.1    JQ785958    AGB87768.1    JQ786172    AGB87982.1    GQ283605    ACT87671.1    JQ786041    AGB87851.1    JQ785801    AGB87611.1    GQ283644    ACT87710.1    JQ786090    AGB87900.1    JQ785771    AGB87581.1    JQ785755    AGB87565.1    JQ785848    AGB87658.1    JQ786133    AGB87943.1    GQ283661    ACT87727.1    EU032817    ABW39084.1    EU479203    ACD01633.1    EU032870    ABW39137.1    GQ283617    ACT87683.1    EU479217    ACD01647.1    EU479223    ACD01653.1    EU032862    ABW39129.1    EU479187    ACD01617.1    JQ786126    AGB87936.1    JQ785653    AGB87463.1   
Pfam
PF00282   Pyridoxal_deC        + More
PF01593   Amino_oxidase
Interpro
IPR002129   PyrdxlP-dep_de-COase        + More
IPR015421   PyrdxlP-dep_Trfase_major       
IPR021115   Pyridoxal-P_BS       
IPR015424   PyrdxlP-dep_Trfase       
IPR010977   Aromatic_deC       
IPR015422   PyrdxlP-dep_Trfase_dom1       
IPR002937   Amino_oxidase       
IPR036188   FAD/NAD-bd_sf       
SUPFAM
SSF53383   SSF53383        + More
SSF51905   SSF51905       
Gene 3D
PDB
3K40     E-value=0,     Score=1970

Ontologies

Topology

Length:
478
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.33659
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.05143
outside
1  -  478
 
 

Population Genetic Test Statistics

Pi
203.580724
Theta
181.69458
Tajima's D
0.198578
CLR
0.7315
CSRT
0.427728613569322
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号