SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02032
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.195 Nuclear   Reliability : 1.697
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCTCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACTTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCTTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAAGCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGTAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAGCTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRALDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQAVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNVSCSSYGTSCRTALFDIESREPAPPHDLSQLESRKALSSHPSYLAYSSTIFPGRRRPI

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GGMS01006359    MBY75562.1    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    ABLF02042385    GGMR01015412    MBY28031.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMR01018716    MBY31335.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02042518    ABLF02057746    ABLF02008153    ABLF02008462    ABLF02008464    GALX01005359    JAB63107.1    GGMR01016297    MBY28916.1    KK115285    KFM64681.1    GFTR01008262    JAW08164.1    GEDC01029594    JAS07704.1    GFTR01008279    JAW08147.1    GGMR01004661    MBY17280.1    ABLF02040174    ABLF02040183    ABLF02055266    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GEBQ01004157    JAT35820.1    KK119261    KFM75202.1    GGMR01000226    MBY12845.1    ABLF02024246    NEVH01006736    PNF36716.1    KK118005    KFM71947.1    GGMR01006581    MBY19200.1    GFTR01008271    JAW08155.1    GGMR01012443    MBY25062.1    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01002322    MBY14941.1    GFTR01008261    JAW08165.1    GEZM01084970    JAV60359.1    ABLF02034467    GFTR01008038    JAW08388.1    KK113281    KFM59799.1    GGMR01013409    MBY26028.1    GEZM01084969    JAV60363.1    GEZM01053022    JAV74219.1    GGMS01002786    MBY71989.1    GGMR01016905    MBY29524.1    GFTR01008260    JAW08166.1    AY060438    AAL25477.1    GGMS01002992    MBY72195.1    GFXV01000908    MBW12713.1    GGMR01003864    MBY16483.1    LBMM01014024    KMQ85369.1    GFTR01008251    JAW08175.1    ABLF02041767    GFTR01008256    JAW08170.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01011985    PNF31054.1    GGMS01006655    MBY75858.1    NEVH01005277    PNF39135.1    KF280391    AIE77315.1    NEVH01021205    PNF19912.1    ABLF02028535    ABLF02028545    GFXV01002840    MBW14645.1    NWSH01007753    PCG62823.1    GFTR01007929    JAW08497.1    NEVH01023280    PNF18085.1    ABLF02023911    GFTR01008257    JAW08169.1    ABLF02041861    GGMR01000676    MBY13295.1    NNAY01003095    OXU19992.1    ABLF02012739    ABLF02012741    ABLF02022418    GGMR01012676    MBY25295.1    NEVH01019963    PNF22185.1    AF237761    AAF81411.1    ABLF02013806    ABLF02016612    GEZM01021881    JAV88842.1    GBBI01004571    JAC14141.1    NEVH01002556    PNF42024.1    GGMR01006408    MBY19027.1    GGMR01011511    MBY24130.1    ABLF02034460    GFTR01008246    JAW08180.1    ABLF02065839    NEVH01022639    PNF18527.1    GGMS01017365    MBY86568.1    ABLF02023551    ABLF02023561    GGMR01003407    MBY16026.1    GECL01003538    JAP02586.1    ABLF02016634    GFTR01008151    JAW08275.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF04937   DUF659
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
IPR036397   RNaseH_sf       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
604
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.29073999999999
Exp number, first 60 AAs:
0.05473
Total prob of N-in:
0.03063
outside
1  -  604
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.000027
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号