Gene
KWMTBOMO01989 Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013548
Annotation
PREDICTED:_cullin-3-A_[Bombyx_mori]
Full name
Cullin-3-A
+ More
Cullin-3
Cullin-3
Location in the cell
Cytoplasmic Reliability : 1.237 Mitochondrial Reliability : 1.054 Nuclear Reliability : 1.724
Sequence
CDS
ATGAAAAGTACTTTGCCAAAAGACAAAATACCTGGCAAAATGAGGATCAGAGCTTTCCCTATGACTATGGATGAGAAGTATGTGGAGCGTATATGGAGCTTGTTAAAGAATGCCATACAAGAAATACAAAAGAAAAACAACTCTGGACTATCATTTGAAGAGCTTTACCGTAATGCATATACAATGGTACTGCACAAACATGGAGAAAGACTATACACTGGCCTCAAGGAAGTAGTCACTCAACATCTTGAAACTAAGGTCCGAGAAGATGTATTGCATTCATTACACAATGGTTTCTTACAAACTCTCAACAATGCATGGACTGACCATCAAACCAGCATGGTCATGATAAGAGATATTTTGATGTATATGGACAGAGTTTTTGTTCAACAAAATGAAGTTGACAATGTCTACAATCTTGGGCTCATTATCTTCCGAGATCAAGTTGTTCGTTATGGATGCATTCGAGATCATCTTCGTCAGACACTGCTAGAGCTAGTTGCTCGTGAACGTCGCGGCGAAGTTGTGGATCGTCTGGCGATTCGAAACGCCTGTCAGATGCTCATGGTTCTCGGTATCAACTCCCGAGCTGTTTATGAAGAAGACTTTGAAAAACCTTTCCTGCATCAGTCATCTGAATTTTATAGAATGGAATCTCAGAAGTTCCTGGCGGAGAACAGCGCGGCCGTGTACATCAACCGCGTGGAGGCCCGCATCTCTGAGGAGGCGGAGCGCGCGCGGCACTACCTGGACGAGTCCACCGAGCCGCGGGTTGTCTCCGTACTCGAGCACGAACTCATCGAGCGACACATGAAGACTATTGTCGAGATGGAGAACTCTGGCGTGGTGCACATGTTGACGCACACGCGCACGTCGGAGCTGGGCTGCGTGTACAAGCTGCTGTCGCGCGTCGGGGAGGGGCTGCGCACGGTGGCCGACGCCGTGTCCGCGCACCTCCGCGAGCAGGGCCGCGCGCTCGTCACCGACACGCTGCACAACACCAACGCCATCGCATACGTTCAGAACCTTCTTGATCTAAAGGACCGATTTGACCATTTCCTACAAAATTCATTCAACAACGATAAAATATTCAAGCACATGATCACGTCAGACTTCGAATACTTCCTTAACTTGAATAATAAGTCACCGGAATTCTTGTCATTGTTCATTGATGGAAAATTAAAGAAAGGCGAAAAGGGGATGAGCGAACAGGAAATCGAAGCTGTGCTGGATAAAACAATGGTACTATTCCGATTTTTACAAGAGAAGGACGTTTTCGAACGTTATTATAAACAGCATCTAGCGAAACGGCTCTTACTCAATAAGTCTGTCTCTGATGACAGTGAAAAGAACATGATCTCCAAACTTAAGACTGAGTGTGGTTGTCAGTTCACATCAAAATTAGAGGGTATGTTCAAGGATATGACCGTCTCTAACACCATCATGGATGAATTTAAGGAACACGTGCTCTCTAGTGGGCTGAACTTGTACGGAGTGGATCTGTCCGTCCGAGTGCTCACGACCGGCTTCTGGCCGACGCAGAGCGCGACGCCGAAGTGCAACATACCGGCCGCGCCCAGGAACGCGTTCGAAGTCTTCAGAAGCTTCTACTTGGCGAAGCACTCCGGGCGGCAGCTGTCCCTGCAGCCGCAGCTGGGCAGCGCGGACCTGCACGCCACGTTCGGCGCCGCGCCCGCCTCCCCGCCCGCGCCCGCCGCGCCGCGCCGCCACATCATACAGGTCTCCACCTTCCAGATGTGCGTCTTGCTGCTCTTCAACCAGCGCGACCGTCTCACCTACGAGGAATTACTCAATGAGACTGATATACCGGAAAAGGATTTAGTCCGCGCGCTTCAATCGTTGGCCATGGGCAAGCCGACCCAACGAATTCTCATCAAACATCCTAAAACTAAAGAAATTGAGCCCTCACATCAGTTTTACGTCAATGATGCCTTCACATCTAAGTTACATAGAGTTAAGATACAAACGGTAGCCGCGAAGGGAGAGTCGGAGCCGGAACGGCGCGAGACCCGCAACAAGGTGGACGAGGACCGCAAGCACGAGATCGAAGCGGCCATCGTGCGCATCATGAAAGCCAGGAAGAAAATGGCACACACGCTGCTGGTGGCGGAGGTGACGGAGCAGCTGCGCGTGCGCTTCCTGCCGTCGCCGGTCGTCATCAAGAAGCGCATCGAGGGACTCATCGAGCGGGAGTACCTCGCGCGCACGCCCGACGACCGCAAGGTGTACAACTACGTCGCATAG
Protein
MKSTLPKDKIPGKMRIRAFPMTMDEKYVERIWSLLKNAIQEIQKKNNSGLSFEELYRNAYTMVLHKHGERLYTGLKEVVTQHLETKVREDVLHSLHNGFLQTLNNAWTDHQTSMVMIRDILMYMDRVFVQQNEVDNVYNLGLIIFRDQVVRYGCIRDHLRQTLLELVARERRGEVVDRLAIRNACQMLMVLGINSRAVYEEDFEKPFLHQSSEFYRMESQKFLAENSAAVYINRVEARISEEAERARHYLDESTEPRVVSVLEHELIERHMKTIVEMENSGVVHMLTHTRTSELGCVYKLLSRVGEGLRTVADAVSAHLREQGRALVTDTLHNTNAIAYVQNLLDLKDRFDHFLQNSFNNDKIFKHMITSDFEYFLNLNNKSPEFLSLFIDGKLKKGEKGMSEQEIEAVLDKTMVLFRFLQEKDVFERYYKQHLAKRLLLNKSVSDDSEKNMISKLKTECGCQFTSKLEGMFKDMTVSNTIMDEFKEHVLSSGLNLYGVDLSVRVLTTGFWPTQSATPKCNIPAAPRNAFEVFRSFYLAKHSGRQLSLQPQLGSADLHATFGAAPASPPAPAAPRRHIIQVSTFQMCVLLLFNQRDRLTYEELLNETDIPEKDLVRALQSLAMGKPTQRILIKHPKTKEIEPSHQFYVNDAFTSKLHRVKIQTVAAKGESEPERRETRNKVDEDRKHEIEAAIVRIMKARKKMAHTLLVAEVTEQLRVRFLPSPVVIKKRIEGLIEREYLARTPDDRKVYNYVA
Summary
Description
Probable core component of cullin-based SCF-like E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit. Involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division (By similarity).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (By similarity). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1 (By similarity). The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4. The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination. The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB. The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation. The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway. The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification. Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41. In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (By similarity). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (By similarity).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (By similarity). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme (By similarity). The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1 (By similarity). The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component (By similarity). BCR(KLHL42) is involved in ubiquitination of KATNA1 (By similarity). BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3 (By similarity). Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity (By similarity). BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis (By similarity). BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (By similarity). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (By similarity). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (By similarity). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation. The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (By similarity). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (By similarity). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (By similarity). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition (By similarity). Involved in the ubiquitination of KEAP1, ENC1 and KLHL41 (By similarity). In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM (By similarity). The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (By similarity). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (By similarity).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (PubMed:27565346). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1. The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839, PubMed:27716508). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (PubMed:23387299, PubMed:23453970, PubMed:23576762). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (PubMed:20389280, PubMed:21840486, PubMed:21670212, PubMed:24768539). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (PubMed:19995937). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation (PubMed:23455478). The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (PubMed:29769719). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (PubMed:22578813). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (PubMed:26399832). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41. In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (PubMed:25270598). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (PubMed:27798626).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (By similarity). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1 (By similarity). The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4. The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination. The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB. The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation. The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway. The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification. Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41. In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (By similarity). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (By similarity).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (By similarity). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme (By similarity). The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1 (By similarity). The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component (By similarity). BCR(KLHL42) is involved in ubiquitination of KATNA1 (By similarity). BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3 (By similarity). Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity (By similarity). BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis (By similarity). BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (By similarity). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (By similarity). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (By similarity). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation. The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (By similarity). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (By similarity). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (By similarity). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition (By similarity). Involved in the ubiquitination of KEAP1, ENC1 and KLHL41 (By similarity). In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM (By similarity). The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (By similarity). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (By similarity).
Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (PubMed:27565346). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1. The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, H2AFY and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839, PubMed:27716508). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (PubMed:23387299, PubMed:23453970, PubMed:23576762). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (PubMed:20389280, PubMed:21840486, PubMed:21670212, PubMed:24768539). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (PubMed:19995937). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation (PubMed:23455478). The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (PubMed:29769719). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (PubMed:22578813). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (PubMed:26399832). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41. In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (PubMed:25270598). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (PubMed:27798626).
Subunit
Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of cul3, rbx1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit (By similarity). Interacts with btbd6 (PubMed:18855900).
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1. Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (By similarity). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1. Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (By similarity). Interacts with COPS9 (By similarity). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (By similarity). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (By similarity). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24 (By similarity). Interacts with RHOBTB2.
Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of cul3, rbx1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. Interacts with btbd6 (By similarity).
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1. Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (By similarity). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1. Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (By similarity). Interacts with COPS9 (By similarity). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (By similarity). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (By similarity). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24. Interacts with RHOBTB2.
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1 (PubMed:10500095, PubMed:10230407, PubMed:12609982). Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (Probable). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1 (PubMed:26399832). Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1 (PubMed:25270598). Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (PubMed:24076655, PubMed:27565346). Interacts with COPS9 isoform 2 (PubMed:23776465). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (PubMed:23135275). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (PubMed:27561354). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24 (PubMed:27798626). Interacts with RHOBTB2 (PubMed:29276004).
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1. Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (By similarity). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1. Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (By similarity). Interacts with COPS9 (By similarity). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (By similarity). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (By similarity). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24 (By similarity). Interacts with RHOBTB2.
Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of cul3, rbx1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. Interacts with btbd6 (By similarity).
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1. Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (By similarity). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1. Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (By similarity). Interacts with COPS9 (By similarity). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (By similarity). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (By similarity). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24. Interacts with RHOBTB2.
Forms neddylation-dependent homodimers. Component of multiple BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes formed of CUL3, RBX1 and a variable BTB domain-containing protein acting as both, adapter to cullin and substrate recognition subunit. The BCR complex may be active as a heterodimeric complex, in which NEDD8, covalently attached to one CUL3 molecule, binds to the C-terminus of a second CUL3 molecule. Interacts with RBX1, RNF7, CYCE and TIP120A/CAND1 (PubMed:10500095, PubMed:10230407, PubMed:12609982). Part of the BCR(SPOP) containing SPOP, and of BCR containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL. Part of the probable BCR(KLHL9-KLHL13) complex with BTB domain proteins KLHL9 and KLHL13. Part of the BCR(KLHL41) complex containing KLHL41. Component of the BCR(KLHL12) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL12 and RBX1. Component of the BCR(KLHL3) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL3 and RBX1 (Probable). Part of the BCR(ENC1) complex containing ENC1. Part of a complex consisting of BMI1/PCGF4, CUL3 and SPOP. Part of a complex consisting of BRMS1, CUL3 and SPOP. Component of the BCR(KLHL21) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL21 and RBX1. Component of the BCR(KLHL22) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL22 and RBX1. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Part of a complex consisting of H2AFY, CUL3 and SPOP. Component of the BCR(KLHL42) E3 ubiquitin ligase complex, at least composed of CUL3 and KLHL42. Interacts with KLHL42 (via the BTB domain). Interacts with KATNA1; the interaction is enhanced by KLHL42. Component of the BCR(KBTBD8) E3 ubiquitin ligase complex, at least composed of CUL3, KBTBD8 and RBX1 (PubMed:26399832). Interacts with KCTD5, KLHL9, KLHL11, KLHL13, GAN, ZBTB16, KLHL3, KLHL15, KLHL20, KLHL36, GMCL2, BTBD1. Part of a complex that contains CUL3, RBX1 and GAN. Interacts (via BTB domain) with KLHL17; the interaction regulates surface GRIK2 expression. Interacts with KCTD7. Part of the BCR(GAN) complex containing GAN. Part of the BCR(KEAP1) complex containing KEAP1. Interacts with KLHL10 (By similarity). Interacts with KAT5 and ATF2. Interacts with DCUN1D3. Interacts with KCTD17 in the BCR(KCTD17) E3 ubiquitin ligase complex, at least composed of CUL3, KCTD17 and RBX1 (PubMed:25270598). Interacts (when neddylated) with ARIH1; leading to activate the E3 ligase activity of ARIH1 (PubMed:24076655, PubMed:27565346). Interacts with COPS9 isoform 2 (PubMed:23776465). Interacts with PPP2R5B; this interaction is indirect and mediated through KLHL15-binding and leads to PPP2R5B proteasomal degradation (PubMed:23135275). Interacts with RBBP8/CtIP; this interaction is indirect and mediated through KLHL15-binding and leads to RBBP8 proteasomal degradation (PubMed:27561354). Interacts with KLHL24 in the BCR(KLHL24) E3 ubiquitin ligase complex, composed of CUL3, RBX1 and KLHL24 (PubMed:27798626). Interacts with RHOBTB2 (PubMed:29276004).
Similarity
Belongs to the cullin family.
Keywords
ER-Golgi transport
Isopeptide bond
Nucleus
Transport
Ubl conjugation
Acetylation
Cell projection
Cilium
Complete proteome
Cytoplasm
Flagellum
Golgi apparatus
Phosphoprotein
Reference proteome
Ubl conjugation pathway
3D-structure
Alternative splicing
Disease mutation
Polymorphism
Feature
chain Cullin-3-A
splice variant In isoform 2.
sequence variant In dbSNP:rs2969802.
splice variant In isoform 2.
sequence variant In dbSNP:rs2969802.
Uniprot
A0A2A4JJ40
S4PTG6
A0A212ESW2
A0A1B6H9V2
A0A1B6JWD1
A0A069DW75
+ More
A0A0V0G6Z1 V5GUU2 R4WJZ3 A0A023FCK0 D6WNA9 A0A1Y1ML61 T1HP38 A0A1W4X622 A0A224X809 A0A1Y1ML57 H9JVI5 A0A1W4WV81 A0A131Y2X2 C3ZDY2 A0A1S3JBC6 A0A224YWA0 A0A131Z1V1 A0A1E1XK25 A0A1E1XG03 U5EMD6 A0A131XAU2 A0A023FKE5 L7MH89 N6UCE3 Q173E4 V9KFK4 W5M8M2 A0A1L8DTA3 A0A1L8GAJ9 A0A1W4Y921 A0A2U9B5Y0 Q6DE95 A0A3P8TPH4 B3DIU1 A0A1U7QN73 B5DF89 A0A3B3CZ17 A0A226PUC8 E1BYQ3 F6NVK8 Q6P0Z1 A0A1A8HG66 A0A1A8J721 A0A1A7XGC5 Q6ZQ84 A4IHP4 A0A3P8WYM9 A0A3B4Y5K5 A0A3B4G2M2 A0A3B5AYW1 A0A151NAI8 A0A3L8SBF9 A0A2I4C0V8 A0A0F7Z6H3 A0A218UZD2 A0A0F8C007 Q6TEL5 A0A0B8RS17 I3KIV1 A0A2D4PJ85 A0A1W7RI92 A0A3P8P101 A0A098M0X6 A0A3P9BKB6 A0A1A8UM31 A0A0F7ZBV5 A0A2H6N8Z8 T1DCM3 A0A0P6J9P9 A0A250YL56 A0A2K5W2Z2 K9INP5 A0A287A2J9 A0A0D9R5T3 A0A2U4AE73 A0A096NYI1 F6UH62 A0A2Y9SNR1 A0A2Y9GHN9 M3W920 A0A2K5N3V8 A0A2Y9KWQ8 A0A2Y9MRH6 E1BIN5 A0A2U3WFR0 H2P8S3 H2QJJ1 F6R900 A0A024R475 Q9JLV5 Q13618 A0A1L8G4G3 A0A3B3RXZ6 A0A3B4T2J8
A0A0V0G6Z1 V5GUU2 R4WJZ3 A0A023FCK0 D6WNA9 A0A1Y1ML61 T1HP38 A0A1W4X622 A0A224X809 A0A1Y1ML57 H9JVI5 A0A1W4WV81 A0A131Y2X2 C3ZDY2 A0A1S3JBC6 A0A224YWA0 A0A131Z1V1 A0A1E1XK25 A0A1E1XG03 U5EMD6 A0A131XAU2 A0A023FKE5 L7MH89 N6UCE3 Q173E4 V9KFK4 W5M8M2 A0A1L8DTA3 A0A1L8GAJ9 A0A1W4Y921 A0A2U9B5Y0 Q6DE95 A0A3P8TPH4 B3DIU1 A0A1U7QN73 B5DF89 A0A3B3CZ17 A0A226PUC8 E1BYQ3 F6NVK8 Q6P0Z1 A0A1A8HG66 A0A1A8J721 A0A1A7XGC5 Q6ZQ84 A4IHP4 A0A3P8WYM9 A0A3B4Y5K5 A0A3B4G2M2 A0A3B5AYW1 A0A151NAI8 A0A3L8SBF9 A0A2I4C0V8 A0A0F7Z6H3 A0A218UZD2 A0A0F8C007 Q6TEL5 A0A0B8RS17 I3KIV1 A0A2D4PJ85 A0A1W7RI92 A0A3P8P101 A0A098M0X6 A0A3P9BKB6 A0A1A8UM31 A0A0F7ZBV5 A0A2H6N8Z8 T1DCM3 A0A0P6J9P9 A0A250YL56 A0A2K5W2Z2 K9INP5 A0A287A2J9 A0A0D9R5T3 A0A2U4AE73 A0A096NYI1 F6UH62 A0A2Y9SNR1 A0A2Y9GHN9 M3W920 A0A2K5N3V8 A0A2Y9KWQ8 A0A2Y9MRH6 E1BIN5 A0A2U3WFR0 H2P8S3 H2QJJ1 F6R900 A0A024R475 Q9JLV5 Q13618 A0A1L8G4G3 A0A3B3RXZ6 A0A3B4T2J8
Pubmed
23622113
22118469
26334808
23691247
25474469
18362917
+ More
19820115 28004739 19121390 29652888 18563158 26383154 28797301 26830274 29209593 28503490 28049606 25576852 23537049 17510324 24402279 27762356 18855900 23594743 28071753 15057822 15489334 17062563 29451363 24621616 15592404 14621295 24487278 22293439 30282656 25835551 15520368 25476704 25186727 26358130 23758969 25727380 28087693 17495919 17975172 19393038 16136131 17431167 25319552 11181995 10500095 16162871 21183079 22358839 9733711 9734811 9663463 14702039 15815621 8681378 11311237 10597293 10230407 12609982 14528312 15983046 15897469 16524876 17543862 17254749 17192413 18573101 18397884 19261606 19995937 20389280 21269460 22085717 21840486 21670212 22748208 23135275 22578813 22814378 23387299 23453970 24076655 23186163 23455478 23776465 23576762 25349211 24768539 25270598 26399832 27716508 27565346 27561354 27798626 28395323 29276004 29769719 22632832 23573258 23349464 22266938 25969726 29240929
19820115 28004739 19121390 29652888 18563158 26383154 28797301 26830274 29209593 28503490 28049606 25576852 23537049 17510324 24402279 27762356 18855900 23594743 28071753 15057822 15489334 17062563 29451363 24621616 15592404 14621295 24487278 22293439 30282656 25835551 15520368 25476704 25186727 26358130 23758969 25727380 28087693 17495919 17975172 19393038 16136131 17431167 25319552 11181995 10500095 16162871 21183079 22358839 9733711 9734811 9663463 14702039 15815621 8681378 11311237 10597293 10230407 12609982 14528312 15983046 15897469 16524876 17543862 17254749 17192413 18573101 18397884 19261606 19995937 20389280 21269460 22085717 21840486 21670212 22748208 23135275 22578813 22814378 23387299 23453970 24076655 23186163 23455478 23776465 23576762 25349211 24768539 25270598 26399832 27716508 27565346 27561354 27798626 28395323 29276004 29769719 22632832 23573258 23349464 22266938 25969726 29240929
EMBL
NWSH01001210
PCG72115.1
GAIX01012073
JAA80487.1
AGBW02012699
OWR44585.1
+ More
GECU01036347 JAS71359.1 GECU01004175 JAT03532.1 GBGD01000576 JAC88313.1 GECL01003079 JAP03045.1 GALX01003044 JAB65422.1 AK417935 BAN21150.1 GBBI01000199 JAC18513.1 KQ971342 EFA03809.2 GEZM01028133 JAV86443.1 ACPB03014848 GFTR01007941 JAW08485.1 GEZM01028134 JAV86442.1 BABH01042287 BABH01042288 BABH01042289 GEFM01002579 GEGO01001351 JAP73217.1 JAR94053.1 GG666612 EEN48938.1 GFPF01006956 MAA18102.1 GEDV01003310 JAP85247.1 GFAA01003764 JAT99670.1 GFAC01000954 JAT98234.1 GANO01001079 JAB58792.1 GEFH01004552 JAP64029.1 GBBK01002111 JAC22371.1 GACK01001478 JAA63556.1 APGK01040876 KB740984 KB631899 ENN76322.1 ERL86969.1 CH477426 CH477384 EAT41142.1 EAT42144.1 JW864052 AFO96569.1 AHAT01029696 GFDF01004559 JAV09525.1 CM004474 OCT80959.1 CP026245 AWO99158.1 BC077239 CU633805 CU633910 LO018546 BC163249 AAI63249.1 BC168969 AWGT02000017 OXB83082.1 AADN05000526 CU570974 BC065357 AAH65357.1 HAEC01013992 SBQ82209.1 HAED01019035 SBR05480.1 HADW01015500 SBP16900.1 AK129174 BAC97984.2 BC135616 AKHW03003627 KYO33852.1 QUSF01000034 RLV99110.1 GBEW01000256 JAI10109.1 MUZQ01000086 OWK59069.1 KQ041854 KKF21639.1 AY423034 AAQ98010.1 GBSH01000750 JAG68275.1 AERX01021592 IACN01073227 LAB58097.1 GDAY02000579 JAV50846.1 GBSI01000627 JAC95869.1 HAEJ01008194 SBS48651.1 GBEX01000827 JAI13733.1 IACI01067281 LAA27247.1 GAAZ01000599 GBKC01000853 GBKD01000537 JAA97344.1 JAG45217.1 JAG47081.1 GEBF01003245 JAO00388.1 GFFW01000413 JAV44375.1 AQIA01016063 AQIA01016064 AQIA01016065 AQIA01016066 AQIA01016067 GABZ01004533 JAA48992.1 AEMK02000101 AQIB01002947 AQIB01002948 AQIB01002949 AQIB01002950 AQIB01002951 AQIB01002952 AQIB01002953 AQIB01002954 AQIB01002955 AQIB01002956 AHZZ02004606 AHZZ02004607 AANG04002752 ABGA01193739 ABGA01193740 ABGA01193741 ABGA01193742 ABGA01193743 ABGA01193744 ABGA01193745 ABGA01193746 ABGA01193747 ABGA01193748 NDHI03003483 PNJ36823.1 AACZ04056585 GABC01004185 GABF01004036 GABD01003173 GABE01007398 NBAG03000230 JAA07153.1 JAA18109.1 JAA29927.1 JAA37341.1 PNI70572.1 JSUE03009723 JU320804 JU472765 JV045608 AFE64560.1 AFH29569.1 AFI35679.1 CH471063 EAW70830.1 AF129738 BC027304 AF064087 AB014517 AF062537 AY337761 AK291151 AC073052 AC092679 BC031844 BC039598 BC092409 U58089 AF052147 CM004475 OCT78757.1
GECU01036347 JAS71359.1 GECU01004175 JAT03532.1 GBGD01000576 JAC88313.1 GECL01003079 JAP03045.1 GALX01003044 JAB65422.1 AK417935 BAN21150.1 GBBI01000199 JAC18513.1 KQ971342 EFA03809.2 GEZM01028133 JAV86443.1 ACPB03014848 GFTR01007941 JAW08485.1 GEZM01028134 JAV86442.1 BABH01042287 BABH01042288 BABH01042289 GEFM01002579 GEGO01001351 JAP73217.1 JAR94053.1 GG666612 EEN48938.1 GFPF01006956 MAA18102.1 GEDV01003310 JAP85247.1 GFAA01003764 JAT99670.1 GFAC01000954 JAT98234.1 GANO01001079 JAB58792.1 GEFH01004552 JAP64029.1 GBBK01002111 JAC22371.1 GACK01001478 JAA63556.1 APGK01040876 KB740984 KB631899 ENN76322.1 ERL86969.1 CH477426 CH477384 EAT41142.1 EAT42144.1 JW864052 AFO96569.1 AHAT01029696 GFDF01004559 JAV09525.1 CM004474 OCT80959.1 CP026245 AWO99158.1 BC077239 CU633805 CU633910 LO018546 BC163249 AAI63249.1 BC168969 AWGT02000017 OXB83082.1 AADN05000526 CU570974 BC065357 AAH65357.1 HAEC01013992 SBQ82209.1 HAED01019035 SBR05480.1 HADW01015500 SBP16900.1 AK129174 BAC97984.2 BC135616 AKHW03003627 KYO33852.1 QUSF01000034 RLV99110.1 GBEW01000256 JAI10109.1 MUZQ01000086 OWK59069.1 KQ041854 KKF21639.1 AY423034 AAQ98010.1 GBSH01000750 JAG68275.1 AERX01021592 IACN01073227 LAB58097.1 GDAY02000579 JAV50846.1 GBSI01000627 JAC95869.1 HAEJ01008194 SBS48651.1 GBEX01000827 JAI13733.1 IACI01067281 LAA27247.1 GAAZ01000599 GBKC01000853 GBKD01000537 JAA97344.1 JAG45217.1 JAG47081.1 GEBF01003245 JAO00388.1 GFFW01000413 JAV44375.1 AQIA01016063 AQIA01016064 AQIA01016065 AQIA01016066 AQIA01016067 GABZ01004533 JAA48992.1 AEMK02000101 AQIB01002947 AQIB01002948 AQIB01002949 AQIB01002950 AQIB01002951 AQIB01002952 AQIB01002953 AQIB01002954 AQIB01002955 AQIB01002956 AHZZ02004606 AHZZ02004607 AANG04002752 ABGA01193739 ABGA01193740 ABGA01193741 ABGA01193742 ABGA01193743 ABGA01193744 ABGA01193745 ABGA01193746 ABGA01193747 ABGA01193748 NDHI03003483 PNJ36823.1 AACZ04056585 GABC01004185 GABF01004036 GABD01003173 GABE01007398 NBAG03000230 JAA07153.1 JAA18109.1 JAA29927.1 JAA37341.1 PNI70572.1 JSUE03009723 JU320804 JU472765 JV045608 AFE64560.1 AFH29569.1 AFI35679.1 CH471063 EAW70830.1 AF129738 BC027304 AF064087 AB014517 AF062537 AY337761 AK291151 AC073052 AC092679 BC031844 BC039598 BC092409 U58089 AF052147 CM004475 OCT78757.1
Proteomes
UP000218220
UP000007151
UP000007266
UP000015103
UP000192223
UP000005204
+ More
UP000001554 UP000085678 UP000019118 UP000030742 UP000008820 UP000018468 UP000186698 UP000192224 UP000246464 UP000265080 UP000000437 UP000189706 UP000002494 UP000261560 UP000198419 UP000000539 UP000008143 UP000265120 UP000261360 UP000261460 UP000261400 UP000050525 UP000276834 UP000192220 UP000197619 UP000005207 UP000265100 UP000265160 UP000233100 UP000008227 UP000029965 UP000245320 UP000028761 UP000002280 UP000248484 UP000248481 UP000011712 UP000233060 UP000248482 UP000248483 UP000009136 UP000245340 UP000001595 UP000002277 UP000006718 UP000000589 UP000005640 UP000261540 UP000261420
UP000001554 UP000085678 UP000019118 UP000030742 UP000008820 UP000018468 UP000186698 UP000192224 UP000246464 UP000265080 UP000000437 UP000189706 UP000002494 UP000261560 UP000198419 UP000000539 UP000008143 UP000265120 UP000261360 UP000261460 UP000261400 UP000050525 UP000276834 UP000192220 UP000197619 UP000005207 UP000265100 UP000265160 UP000233100 UP000008227 UP000029965 UP000245320 UP000028761 UP000002280 UP000248484 UP000248481 UP000011712 UP000233060 UP000248482 UP000248483 UP000009136 UP000245340 UP000001595 UP000002277 UP000006718 UP000000589 UP000005640 UP000261540 UP000261420
Interpro
Gene 3D
ProteinModelPortal
A0A2A4JJ40
S4PTG6
A0A212ESW2
A0A1B6H9V2
A0A1B6JWD1
A0A069DW75
+ More
A0A0V0G6Z1 V5GUU2 R4WJZ3 A0A023FCK0 D6WNA9 A0A1Y1ML61 T1HP38 A0A1W4X622 A0A224X809 A0A1Y1ML57 H9JVI5 A0A1W4WV81 A0A131Y2X2 C3ZDY2 A0A1S3JBC6 A0A224YWA0 A0A131Z1V1 A0A1E1XK25 A0A1E1XG03 U5EMD6 A0A131XAU2 A0A023FKE5 L7MH89 N6UCE3 Q173E4 V9KFK4 W5M8M2 A0A1L8DTA3 A0A1L8GAJ9 A0A1W4Y921 A0A2U9B5Y0 Q6DE95 A0A3P8TPH4 B3DIU1 A0A1U7QN73 B5DF89 A0A3B3CZ17 A0A226PUC8 E1BYQ3 F6NVK8 Q6P0Z1 A0A1A8HG66 A0A1A8J721 A0A1A7XGC5 Q6ZQ84 A4IHP4 A0A3P8WYM9 A0A3B4Y5K5 A0A3B4G2M2 A0A3B5AYW1 A0A151NAI8 A0A3L8SBF9 A0A2I4C0V8 A0A0F7Z6H3 A0A218UZD2 A0A0F8C007 Q6TEL5 A0A0B8RS17 I3KIV1 A0A2D4PJ85 A0A1W7RI92 A0A3P8P101 A0A098M0X6 A0A3P9BKB6 A0A1A8UM31 A0A0F7ZBV5 A0A2H6N8Z8 T1DCM3 A0A0P6J9P9 A0A250YL56 A0A2K5W2Z2 K9INP5 A0A287A2J9 A0A0D9R5T3 A0A2U4AE73 A0A096NYI1 F6UH62 A0A2Y9SNR1 A0A2Y9GHN9 M3W920 A0A2K5N3V8 A0A2Y9KWQ8 A0A2Y9MRH6 E1BIN5 A0A2U3WFR0 H2P8S3 H2QJJ1 F6R900 A0A024R475 Q9JLV5 Q13618 A0A1L8G4G3 A0A3B3RXZ6 A0A3B4T2J8
A0A0V0G6Z1 V5GUU2 R4WJZ3 A0A023FCK0 D6WNA9 A0A1Y1ML61 T1HP38 A0A1W4X622 A0A224X809 A0A1Y1ML57 H9JVI5 A0A1W4WV81 A0A131Y2X2 C3ZDY2 A0A1S3JBC6 A0A224YWA0 A0A131Z1V1 A0A1E1XK25 A0A1E1XG03 U5EMD6 A0A131XAU2 A0A023FKE5 L7MH89 N6UCE3 Q173E4 V9KFK4 W5M8M2 A0A1L8DTA3 A0A1L8GAJ9 A0A1W4Y921 A0A2U9B5Y0 Q6DE95 A0A3P8TPH4 B3DIU1 A0A1U7QN73 B5DF89 A0A3B3CZ17 A0A226PUC8 E1BYQ3 F6NVK8 Q6P0Z1 A0A1A8HG66 A0A1A8J721 A0A1A7XGC5 Q6ZQ84 A4IHP4 A0A3P8WYM9 A0A3B4Y5K5 A0A3B4G2M2 A0A3B5AYW1 A0A151NAI8 A0A3L8SBF9 A0A2I4C0V8 A0A0F7Z6H3 A0A218UZD2 A0A0F8C007 Q6TEL5 A0A0B8RS17 I3KIV1 A0A2D4PJ85 A0A1W7RI92 A0A3P8P101 A0A098M0X6 A0A3P9BKB6 A0A1A8UM31 A0A0F7ZBV5 A0A2H6N8Z8 T1DCM3 A0A0P6J9P9 A0A250YL56 A0A2K5W2Z2 K9INP5 A0A287A2J9 A0A0D9R5T3 A0A2U4AE73 A0A096NYI1 F6UH62 A0A2Y9SNR1 A0A2Y9GHN9 M3W920 A0A2K5N3V8 A0A2Y9KWQ8 A0A2Y9MRH6 E1BIN5 A0A2U3WFR0 H2P8S3 H2QJJ1 F6R900 A0A024R475 Q9JLV5 Q13618 A0A1L8G4G3 A0A3B3RXZ6 A0A3B4T2J8
PDB
4AP2
E-value=6.88943e-152,
Score=1381
Ontologies
PATHWAY
GO
GO:0031625
GO:0006511
GO:0031461
GO:0043161
GO:0031146
GO:0019005
GO:0016874
GO:0045842
GO:0017145
GO:0006513
GO:0007229
GO:0007080
GO:0043149
GO:0005827
GO:0006888
GO:0035024
GO:0048208
GO:0040016
GO:0031463
GO:0005634
GO:0016477
GO:0000139
GO:0016567
GO:0036126
GO:0032467
GO:0071630
GO:0031208
GO:0030030
GO:0005737
GO:0000209
GO:0000122
GO:0000902
GO:0031398
GO:0042803
GO:0007369
GO:0046982
GO:0031145
GO:0072576
GO:0031648
GO:0044346
GO:0004842
GO:0005112
GO:0030332
GO:0016055
GO:0001831
GO:0000278
GO:0005794
GO:0001701
GO:0006357
GO:0005654
GO:0008284
GO:0005829
GO:0043687
GO:0000165
GO:0070062
GO:0016020
GO:0097193
GO:0090090
GO:0000082
GO:0004983
GO:0008168
GO:0016876
GO:0043039
GO:0004651
Topology
Subcellular location
Nucleus
Golgi apparatus Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cell projection Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cilium Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Flagellum Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cytoplasm Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Golgi apparatus Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cell projection Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cilium Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Flagellum Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Cytoplasm Detected along the length of the sperm flagellum and in the cytoplasm of the germ cells. With evidence from 3 publications.
Length:
754
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01687
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00084
outside
1 - 754
Population Genetic Test Statistics
Pi
18.102642
Theta
18.481008
Tajima's D
-1.484142
CLR
0.973666
CSRT
0.0602469876506175
Interpretation
Uncertain
