SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01985
Annotation
hypothetical_protein_TcasGA2_TC031778_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.252
 

Sequence

CDS
ATGGTTTTTACGATAAAATTTTTATCCCTACAAAAAACTGAACTGGAATACGAAGTCGCGATAAGAGGTGAGACCCCCGGTGCTACGGTGGCTGATCTTAGGAAACAGATTAGCAAATTAAGTCAATCTTTTCCTTCAGAAGATATATTATGTTCTCATCTCGAACCCCTAGATGATCTTCAAGCTGTTTTGGACTTGCTGAATAAAGTCAATGCAAGTCTCGAGTCAAGCCCTACTGATAAAAGTACATTATCGCGCATAGAAAATATTTTTCATCACCTTTATCATAGGATCAACAGAATAGTGGTTGATGAAGTAGAGAAGCCGCACTCTGCTTGTAGTAAATTTTTTAAAGAATCCTACGAAAAATTCCAGAAATTAAGCAAAAAGGCAGTTGACCCTCTATTAGTTTGTGTATCTAGTTCAGCATCTGCTTCTGTACCTGGCATTCAGGCACCAATTAATGTCGCTGTTACTTGTGATCGAGGTGTTACTTCAGAACTGAGTAGGCTGAAGTTCGATGGTAAATCATGTGTTCGATCTTTTATTCAACGTGTTTACGAATTTAGCGAGGCTCGTAGCATCCCCGACTCAAAACTTCTCTCATCTGCTACAGAAATATTTACAGATGATGCGCTGCATTGGTTCAGGAGTATTAAGGACCAGGTTTCATCTTGGGATGATCTTGTTGTTCTTTTAAAAAAAGATTTTGATAAAGCAGACTATGATTACCGTTTACTTGCTGAGATTCGTGCTAGGACTCAAGGGGAAACGGAAAATATTACGATATACTTAGCTATTCTCTCGGGTATGTTTGCCCGCCTCTTAAAATCACTTTCGGAAGAGGACAAGCTTGAAATAGTATTACATAATATCCGCCCTTGCTATGCAAGCACTCTAGCCTCTGCTACTGAAATATGTAACATTGATCAATTGAGATCCTTGTGCAGGAATTATGAAATTGTTCAGTCTAGGCTCGTCCACTTTCGAGAACCATCTGCAGCGACTTCCGATACCTTGGCACCAGAATTTGCGTACAAATATGCGACCAAGGCGAAATCGACCTACGACTATAAATCTAGCTATAGTTACAACAAACAGTCGTATCAACCATTAAAAATAAACAGGAACACTAATATTAATCAAAAATATCTACACAGTATTGAAGAAAGTCATCACGATGCAAGGGAAAAATTACCCTATTGTCCTAGGTGCCGCAACAATACGCATAGTTTTAGGGACTGCACTAATACGGAAGTTTTGTGTTTTAAGTGTGGTCGCAAGGGAGTTAAGAAACCTGAGTGTTCACATTGTACTGGCAAACAGGCTCCAAAAAAAAAACTAAATTTGCAGAATTGCAGCAAACCATTGTCCCTGGAACATGTAAAGATACACCGTACCAGCCGGGATGAATGGAAGAATTGGTTAAAAACAATTAGTTTATTTTTTAATGGCTACAAGGTTGCTTCAATTCTGCATACAAAACCAACTAACGATAAAAGACCCTATGTTAATATTAAGATACACGATTTGACAGTTTCCGGCCTTTTGGATTCAGGCTCAGCGGTTACTATTTTAGGCAACAATGCTCATAGTGCATTAGTTAGTCGTGGGCTGGAGTTGTGTACTGATGATAAATTGACTATTATTGCGGCTGGTGGACAAAATCTTAGAAGTATAGGCTATATTAATATGCCAGTGCATTTCGAAAACCAGTTCCACATTATTCAGAGTCACGTAGTTCCAGAAGTTCAATCATCGCTTATTTTAGGGATTGACTTTTGGCACACATTTAAAATTTGCCCGAAGTACTTGAGTTCTCTTCATTTCCCCGGCCCTCCATTGGCTAATTTAGATGTTGGTAGCCCAACCAATTTTTTGCGCTCGTATGATTATTTGGACGAATCACAAAAGGCCGTCGTTGACAATATTACCAAGCAGTTTGAAGAAATATCTTTTGAGCGCAAAGGACTTGGACGCACAAACTTAATTACTCACCACATCGACACGGGGAATTCTCCTCCTGTGAGACAGCGCTACTATAGGCTTTCACCAGAGAAACAGAGAATCCTAGTCGAGCAAGTAGACGAAATGCTCCAGCTTGATGTAGTTGAGCCTTGTGAGAGTGCCTGGCAATCCCCGGTATTGCTAGTCACTAAAAAAGATGGTCAGCCGCGGTTCTGCTTAGATAGTAGGAAGCTAAACTCTGTTACAAAACGCGACGCTTATAACTTACCTTACATATCGGAGATATTGGACAACTTGCGAGACGCGCGCTATCTTAGCAGTATTGACTTATCAAAGGCTTTCTGGCAATTACCAATAGCACTCGAAGATAGGGACAAGACGGCATTTTACGTTCCGGGACGAGGGACGTTACGGTTCAAGACTACACCGTTTGGTTTGACCAATGCGCCTTCTACGCAACAGCGGTTAGTCGATTTATTGTTTGGCGACATGGATCACAAGGCGTTCGCATATTTAGATGATGTGATAATAGTAAGTAGCACGTTTGATGAGCATGTTAGTCTTCTTCTTCGCGTGTTAGACAAGCTGCGCCATGCTAATCTAACAATTAATTTAGAAAAGTGTGAATTTTTTCGAAGTAAACTTAAATATTTAGGCTATGTGGTCGACGCGAATGGTTTGCGGACTGATCCGGATAAAGTTACAGCCATTCTAAATTACCCAACTCCTACATGTCGTAAGGACTTGAAACGGTTCCTAGGCACGGCAACATGGTACCGGAGATTTGTCCCAAACTTTAGCACTATCGCAGGGCCGCTTAATAGGTTGTCGAACAAAAAATCAACACCTCCCTTCCAGTGGACAGATGAGGCCGACACTGCGTTCAAAAAACTTAAGGAATCTTTGGTCTCGGCACCTGTTCTCTCCTGCCCAAATTATGATCTGCCTTTCGAAGTCCATACAGATGCAAGTAACTATGGGATAGGTGGTATGCTCACACAAACTATTGACGGGAAAGAGCACCCTATAGCGTATATGAGCAAGTCCTTATCGGGGGCCGAAAAGAATTATAGCATTACCGAACGTGAGACCTTAGCTGTTCTCGTGGCTCTCGAACACTGGCGTTGCTATCTGGAGAACGGAAAGACATTCACAGTTTACACAGACCACAGCGCACTTAAGTGGTTCCTTTCCTTGAACAATCCTACGGGTAGGCTTGCACGTTGGGGAGTTCGATTATCGTCGTTTGATTTTGAAATCAAACACCGCCGCGGTGTAGACAATGTGATTCCCGACGCTTTGTCTAGAGCTGTCCCAGTCAATACTATCACTACTGCTAAATCACTCACGACTTCTAGTGATGATTGGTATAAGACCCTTTATAATAATTGTTTGACCCAGCCTGTACATTATCCAAATCATCATATCAAAAATGACGCTCTTTTCCGTTGTAGTAAGAATAAGTGTTATCTCACAAATGAATTTTCGTGGAAAGAGGTAGTTCCTTCAGAACTTAGAAACACTGTCATTGCTGAGAATCATAGTGAGCCAACAGCTGGTCATTTGGGTATTTTTAAGACCTACAGACGTATCGCCCTTAGATACTATTGGCCAGGCATGTATCGAGACGTAGCAAATTTCGTAGGTTCATGTTCCACTTGTCTCAAGTACAAAATTCAAAACCATGCTACTCTTGGAGAAATGGGTCGCCCCAAGCAGTGCTCTCGACCGTATCAGATGTTATCGATTGATTTAATGGGTCCTTTGCCTGTGACTCGAAAACAAAATTGCCATATTCTAGTGATAACTTGCTGTTTTTCGAAATTTTGTCACATTTATCCAATTAAAAAGGCAACTTCAGACATTATAGTCCGAATTTTAGAAGAGCAAATTTTCCTCGTTCATGGTGTGCCTCAAACAATTTTTCTCGATAATGGCTCTCAGTTCATTAGTAGTCATACAAATGCACTATTCAAAAAGTATAACATACCAAACGTATTTTTCACGCCAAAATATACCCCCCAGGTGAATACCGTAGAGCGGTATAACAAAACAATTATTACTTGTATTTCTACGTTTGTAGATAGTGATCATCGATCATGGGATACTTTTATTCCTAGTGTCCAGTTTGCCATTAATAATTCGGTTAACGAGGCTGCTGGTTTCACTCCGTCATTCCTTGTCTTTGGCAGAGAACTAGTAGTATGTGGCTCTCATTATACTGATATTGATTTGGGTGATCAAGTTTTGTTTCTACCTCGAGATGTGTATGCCGAAAACCTAGGGTGTTTGAGCTCCATCTTCGATCAAGTTCAGAAATCTCTATATCACGCACACGTAAAAAACACTGCTAACTATAATTTACGCAGAAAGCCCTTTGAATTTAATGTAGGAGATACTGTTTATAAACGCGCTTACGTCCTGAGTGACAAAGATAAGTATTTTAGTAAGAAGTTAGCACCGAAATATATCAAGTGCAAAGTTGTCGAAAAACTCTCACCACTTGTCTACGTTCTAGAAGACATGTCGGGTAAAAACATAGGCACTTGGCATATTAAAGACTTGAAAATATTAGGTCAACACTCATAG
Protein
MVFTIKFLSLQKTELEYEVAIRGETPGATVADLRKQISKLSQSFPSEDILCSHLEPLDDLQAVLDLLNKVNASLESSPTDKSTLSRIENIFHHLYHRINRIVVDEVEKPHSACSKFFKESYEKFQKLSKKAVDPLLVCVSSSASASVPGIQAPINVAVTCDRGVTSELSRLKFDGKSCVRSFIQRVYEFSEARSIPDSKLLSSATEIFTDDALHWFRSIKDQVSSWDDLVVLLKKDFDKADYDYRLLAEIRARTQGETENITIYLAILSGMFARLLKSLSEEDKLEIVLHNIRPCYASTLASATEICNIDQLRSLCRNYEIVQSRLVHFREPSAATSDTLAPEFAYKYATKAKSTYDYKSSYSYNKQSYQPLKINRNTNINQKYLHSIEESHHDAREKLPYCPRCRNNTHSFRDCTNTEVLCFKCGRKGVKKPECSHCTGKQAPKKKLNLQNCSKPLSLEHVKIHRTSRDEWKNWLKTISLFFNGYKVASILHTKPTNDKRPYVNIKIHDLTVSGLLDSGSAVTILGNNAHSALVSRGLELCTDDKLTIIAAGGQNLRSIGYINMPVHFENQFHIIQSHVVPEVQSSLILGIDFWHTFKICPKYLSSLHFPGPPLANLDVGSPTNFLRSYDYLDESQKAVVDNITKQFEEISFERKGLGRTNLITHHIDTGNSPPVRQRYYRLSPEKQRILVEQVDEMLQLDVVEPCESAWQSPVLLVTKKDGQPRFCLDSRKLNSVTKRDAYNLPYISEILDNLRDARYLSSIDLSKAFWQLPIALEDRDKTAFYVPGRGTLRFKTTPFGLTNAPSTQQRLVDLLFGDMDHKAFAYLDDVIIVSSTFDEHVSLLLRVLDKLRHANLTINLEKCEFFRSKLKYLGYVVDANGLRTDPDKVTAILNYPTPTCRKDLKRFLGTATWYRRFVPNFSTIAGPLNRLSNKKSTPPFQWTDEADTAFKKLKESLVSAPVLSCPNYDLPFEVHTDASNYGIGGMLTQTIDGKEHPIAYMSKSLSGAEKNYSITERETLAVLVALEHWRCYLENGKTFTVYTDHSALKWFLSLNNPTGRLARWGVRLSSFDFEIKHRRGVDNVIPDALSRAVPVNTITTAKSLTTSSDDWYKTLYNNCLTQPVHYPNHHIKNDALFRCSKNKCYLTNEFSWKEVVPSELRNTVIAENHSEPTAGHLGIFKTYRRIALRYYWPGMYRDVANFVGSCSTCLKYKIQNHATLGEMGRPKQCSRPYQMLSIDLMGPLPVTRKQNCHILVITCCFSKFCHIYPIKKATSDIIVRILEEQIFLVHGVPQTIFLDNGSQFISSHTNALFKKYNIPNVFFTPKYTPQVNTVERYNKTIITCISTFVDSDHRSWDTFIPSVQFAINNSVNEAAGFTPSFLVFGRELVVCGSHYTDIDLGDQVLFLPRDVYAENLGCLSSIFDQVQKSLYHAHVKNTANYNLRRKPFEFNVGDTVYKRAYVLSDKDKYFSKKLAPKYIKCKVVEKLSPLVYVLEDMSGKNIGTWHIKDLKILGQHS

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
PF03732   Retrotrans_gag
PF00077   RVP
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR018061   Retropepsins       
IPR005162   Retrotrans_gag_dom       
IPR003034   SAP_dom       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.72779e-71,     Score=690

Ontologies

Topology

Length:
1518
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00566999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00014
outside
1  -  1518
 
 

Population Genetic Test Statistics

Pi
315.610085
Theta
206.194948
Tajima's D
1.928407
CLR
0.74685
CSRT
0.869106544672766
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号