SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01980
Pre Gene Modal
BGIBMGA005912
Annotation
hypothetical_protein_KGM_03031_[Danaus_plexippus]
Full name
Dipeptidase      
Location in the cell
Mitochondrial   Reliability : 1.592 Nuclear   Reliability : 1.947
 

Sequence

CDS
ATGGTTGATGGAGAAGCCAGCGGCCACGGTGCTACGGTCGGAAACCCACCGTCGGATTGTGTTGATTGTGAAGCTTGCATAGCATTAGCTGCCCAGCGACAGTGTCTAAGTGAACACATATCAAAACATGATTTAGACTTAGTTTGCAATTGTAATATACAACAGAACAACTACCTAAACTGTCATCGAAATGTTTCTGATCATCGAGGCCACACTCTAAATATTTATGATTTAGAGAGAATCAAAAGAGAAACCGATAGAAGTCTAATAAACGTGGGATCACACCAAAGTCTCGACAGAAAACAAACAAGAAATAAATCCATTGGTGTCTCTAATTATATTTCGAAACAATTAATATCGTATGACCCAAGAAATACTCTTGTCCAAAAAATCAAGAGAAAACTATCTAATTTGAAAAAAATCGGCGGAGATGCTATCACCAAGAAACATCAAAACGCTGTCCAACTCGCCGATATAGCATCCGGGTCTACCAGCTCCCTCAAAAAACTATCTATGCTGTCGATTGCGGACAAACCACAAAGAAGAGTTAACAGCCATAGCAACATATATCCATCGACGACAGTAAATAGAGACGACTACAAACACAAAGCGTCAACATACGCAAATTTTTCTGGTAACGTGGACCAATGCTTTGATAGACTGAAAGATTCCAATACAGTCATGGATATAAACAATACGACACAAAAAATAAGAACTTTTGATAACAATCAGGAGCTGATCCGCAGGAATAATGTGGATATAGATGCAATGAAATTTTCTACTTTAGACAATCGAAGCAGATGTAGAAGTATCCGTAGACAACTATCATACAACGATTTTCCTAGTGATCGATGCAAGGAGAAAATCACGGAGACATGGATGACAAATGAAAATACTATTGAGTCCAGGAGTACTCGAAGTGATTTAGTCGACGATGATGTCCACACGTTTATTGACAACGACGTAGTGGCAATGACAGGAACGAGGCCGACACACGCACATTGTACCTGCACCCAGAGCTATGATAATAGAATGCCTTCTTTATTCTACGACTCGCAAGGCAAGAAACGGTCGGCGCCAGCACCTGACGTGACAGAGCGTAGTCAAGGGACTCGCGCAAACGTTTGTAGCGCTTGCAAAGTACCGCAATGGATATCTACTGGTACAACATCGACTACAAGCCACAGTTCAACTACAACTGGAAATTCTTCTCGTTTTTCAATATGGCACCGTCGATGGTGCTGCGTAGCAGTTTTAGTACTGGTAGCCGGGACCGCGTGCGTAGCAGGCCCTCTTGCTTTGAGAGCTCCTCCAGGCGCTCCGATGCATGAAAGACTTCGACTGGCCGAAAGACTATTACACGATACGCCTCTTATCGACGGACACAACGACTTGCCTTGGAATATAAGAAAATTTCTACACAACAAGATTAAAGACTTTTCGTTTGATGAGGACTTGAGGACGATATCACCATGGGCGACGAGCTCGTGGAGCCACACTGATTTGCCGAGGTTAAAACAAGGCAGGGTCGCTGCTCAGTTCTGGGCGGCGTACGTGCCTTGCGATGCGCAACACCGCGACGCCGTGCAGCTGACGTTCGAGCAAATTGACCTCATCCAGCGACTCACTGAAAAATATCAACCTCAGCTTACAATGTGCACTTCTGCCGAAGATATTAAAATAGCGCACGCTAATCATCGTGTATGCTCGTTGATTGGTGTCGAAGGCGGTCACGCTATTGGCAGTTCTCTTGGGGTGCTAAGAACACTGTACCAGGTCGGCGTTCGTTACTTGACATTGACCTCTACTTGTGACACGCCCTGGGCTGAGTGCGCTTCTGCTGACAGAGTTGAACCATCGCCCCGGGGAGGACTCACGGCTTTTGGAAAGGTAGTAATAAAGGAAATGAACAGATTGGGAATGCTAGTGGATTTATCTCACGTGTCAGAGCGAACTATGCGTGATGCTCTGGCTGTCTCACGAGCACCAGTGCTTTTTTCTCACTCTTCTGCACGAGCTCTTTGCAACGTTACTCGTAACGTTCCTGACACAATACTGAGAATGTTAGCTGCCAACAAAGGACTCATAATGGTGAATTTTTATACTTCATTCCTGACTTGTAAGGAAACAGCAACCGTTCAAGATGCGATTGCTCACATAAATCATATACGGAACGTGGCCGGTGTGGACAGCGTCGGCCTTGGCGCCGGGTACGATGGGATTAATTATACACCACAAGGTCTGGAAGATGTATCATCCTATCCATTGTTATTTGCCGAGCTGATGGAGGCAGGCTGGAGCATAGAAGATCTTCGTAAGCTTGCCGGACTGAATCTACTCCGGGTAATGGGCGCAACAGAGAGGGTAGCTAAAGAATTGGCAGCTGCTCGTGTTGTACCTTACGAAGACGTGCCACCGCGAATTTTCGACGCTCATAACTGCTCCAGTCAAGATGTTTAA
Protein
MVDGEASGHGATVGNPPSDCVDCEACIALAAQRQCLSEHISKHDLDLVCNCNIQQNNYLNCHRNVSDHRGHTLNIYDLERIKRETDRSLINVGSHQSLDRKQTRNKSIGVSNYISKQLISYDPRNTLVQKIKRKLSNLKKIGGDAITKKHQNAVQLADIASGSTSSLKKLSMLSIADKPQRRVNSHSNIYPSTTVNRDDYKHKASTYANFSGNVDQCFDRLKDSNTVMDINNTTQKIRTFDNNQELIRRNNVDIDAMKFSTLDNRSRCRSIRRQLSYNDFPSDRCKEKITETWMTNENTIESRSTRSDLVDDDVHTFIDNDVVAMTGTRPTHAHCTCTQSYDNRMPSLFYDSQGKKRSAPAPDVTERSQGTRANVCSACKVPQWISTGTTSTTSHSSTTTGNSSRFSIWHRRWCCVAVLVLVAGTACVAGPLALRAPPGAPMHERLRLAERLLHDTPLIDGHNDLPWNIRKFLHNKIKDFSFDEDLRTISPWATSSWSHTDLPRLKQGRVAAQFWAAYVPCDAQHRDAVQLTFEQIDLIQRLTEKYQPQLTMCTSAEDIKIAHANHRVCSLIGVEGGHAIGSSLGVLRTLYQVGVRYLTLTSTCDTPWAECASADRVEPSPRGGLTAFGKVVIKEMNRLGMLVDLSHVSERTMRDALAVSRAPVLFSHSSARALCNVTRNVPDTILRMLAANKGLIMVNFYTSFLTCKETATVQDAIAHINHIRNVAGVDSVGLGAGYDGINYTPQGLEDVSSYPLLFAELMEAGWSIEDLRKLAGLNLLRVMGATERVAKELAAARVVPYEDVPPRIFDAHNCSSQDV

Summary

Catalytic Activity
Hydrolysis of dipeptides.
Cofactor
Zn(2+)
Subunit
Homodimer; disulfide-linked.
Similarity
Belongs to the metallo-dependent hydrolases superfamily. Peptidase M19 family.
EC Number
3.4.13.19
Pfam
PF01244   Peptidase_M19
Interpro
IPR000180   Dipep_AS        + More
IPR032466   Metal_Hydrolase       
IPR008257   Pept_M19       
SUPFAM
SSF51556   SSF51556       
PDB
1ITU     E-value=3.13976e-89,     Score=841

Ontologies

Topology

Subcellular location
Membrane  
Length:
819
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.36746
Exp number, first 60 AAs:
0
Total prob of N-in:
0.10477
outside
1  -  819
 
 

Population Genetic Test Statistics

Pi
278.525844
Theta
184.635232
Tajima's D
1.608109
CLR
0.005763
CSRT
0.807909604519774
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号