SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01963
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 2.315
 

Sequence

CDS
ATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAGTCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCCTAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAATTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTATTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATGTAGTTAGCAGGAAGGTCGAAAACCCCACTAGAGAAGACGTTACAAAAGTGAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGCGACTCGGATTATGCTGGAGACCCATTGACGAGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCCGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAATAACCGGTTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGGTCGAAGCACATAGACGTGCGGTACCATTTTATACATGAACACTTCGTGCATGGATTAATAAATATTAGCTACTGTCCCACAGAAATTCAGTTAGCTGACGTAATGACAAAACCATTGTCAAAAGTAAAATTTGAAAGACACTGTGCAAGATTAATGCATGTATAG
Protein
MTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVLGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIILTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNVVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQEITGLDIKINLHVDNQSSIQLVKSGSFNKRSKHIDVRYHFIHEHFVHGLINISYCPTEIQLADVMTKPLSKVKFERHCARLMHV

Summary

Similarity
Belongs to the terpene synthase family.
EMBL
GECZ01017843    JAS51926.1    GBHO01040574    JAG03030.1    GBHO01040573    JAG03031.1    + More
GBHO01016409    JAG27195.1    GEDC01029908    JAS07390.1    LBMM01009639    KMQ87973.1    GECL01003258    JAP02866.1    GBHO01035865    JAG07739.1    GBHO01006096    JAG37508.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    GDHC01005053    JAQ13576.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GBHO01031779    JAG11825.1    GBHO01024362    JAG19242.1    GBHO01012744    JAG30860.1    GEZM01048830    JAV76370.1    ABLF02026843    ABLF02042027    GDAI01002967    JAI14636.1    GGMR01009345    MBY21964.1    OIVN01004910    SPD19931.1    OIVN01001707    SPC96839.1    GEZM01078128    GEZM01078127    JAV63002.1    ABLF02043571    ABLF02045585    ABLF02057174    ABLF02063637    ABLF02063640    GDHC01010945    JAQ07684.1    OIVN01001729    SPC97049.1    GBHO01003079    JAG40525.1    OIVN01002268    SPD02135.1    KQ971338    KYB28117.1    LBMM01012536    KMQ86167.1    OIVN01001091    SPC89740.1    LBMM01003976    KMQ92933.1    OIVN01006432    SPD33020.1    OIVN01005024    SPD20514.1    OIVN01000183    SPC75833.1    AAZX01004151    OIVN01001309    SPC92453.1    OIVN01002622    SPD05126.1    OIVN01001052    SPC89229.1    OIVN01003897    SPD14257.1    JYDM01000512    KRZ81798.1    OIVN01004879    SPD19723.1    OIVN01002904    SPD07378.1    OIVN01001196    SPC91020.1    OIVN01000147    SPC75222.1    OIVN01000116    SPC74628.1    OIVN01000230    SPC76722.1    OIVN01005657    SPD23465.1    OIVN01001666    SPC96375.1    OIVN01001890    SPC98658.1    OIVN01002579    SPD04820.1    OIVN01001520    SPC94877.1    OIVN01000557    SPC82046.1    OIVN01001669    SPC96464.1    OIVN01000945    SPC87766.1    OIVN01004563    SPD18125.1    LBMM01008978    KMQ88491.1    OIVN01000609    SPC82932.1    OIVN01003569    SPD12194.1    OIVN01000681    SPC84018.1    CM003612    KYP59970.1    DS568115    OIVN01002256    SPD02034.1    OIVN01002680    SPD05612.1    OIVN01005312    SPD21871.1    OIVN01001762    SPC97349.1    ABLF02066511    OIVN01004603    SPD18338.1    GEZM01017328    JAV90763.1    GEZM01017329    JAV90762.1    OIVN01006259    SPD29117.1    OIVN01005059    SPD20680.1    KL367655    KFD60665.1    GEZM01013586    JAV92451.1    OIVN01000823    SPC86071.1    AAZX01006115    AAZX01021021    OIVN01004167    SPD15821.1    OIVN01006372    SPD31671.1    OIVN01002812    SPD06621.1    OIVN01000042    SPC73124.1    GDIP01229956    JAI93445.1    OIVN01002854    SPD06945.1    OIVN01000036    SPC73022.1    GEZM01040221    GEZM01040220    JAV80932.1    AAZX01004557    GDIP01156971    JAJ66431.1    JYDK01000067    KRX78390.1    OIVN01001022    SPC88819.1    OIVN01006160    SPD26619.1    MRCU01000010    RKK11096.1    GDIP01239569    JAI83832.1    GDIP01034138    JAM69577.1    OIVN01006233    SPD28466.1    LBMM01012672    KMQ86060.1    GDIP01209409    JAJ13993.1    AP008214    BAF22848.2   
Pfam
PF07727   RVT_2        + More
PF13976   gag_pre-integrs
PF00665   rve
PF00098   zf-CCHC
PF01397   Terpene_synth
PF03936   Terpene_synth_C
Interpro
IPR013103   RVT_2        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR008949   Isoprenoid_synthase_dom_sf       
IPR005630   Terpene_synthase_metal-bd       
IPR008930   Terpenoid_cyclase/PrenylTrfase       
IPR034741   Terpene_cyclase-like_1_C       
IPR036965   Terpene_synth_N_sf       
IPR001906   Terpene_synth_N       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF48576   SSF48576       
SSF48239   SSF48239       
Gene 3D

Ontologies

Topology

Length:
398
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00348
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00559
outside
1  -  398
 
 

Population Genetic Test Statistics

Pi
367.868575
Theta
210.925049
Tajima's D
2.211715
CLR
41.095455
CSRT
0.914754262286886
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号