SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01949
Pre Gene Modal
BGIBMGA010114
Annotation
PREDICTED:_uncharacterized_protein_LOC105842017_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.81
 

Sequence

CDS
ATGGAAATCACAAAGCGCATCCGCACCCTTTGTCAGCGAGCGCCGCCGGCACACCTGCAACGGTCGACGGCAGGCGGCTTGGATCACAGAGGGCGTCGGCACCCTTTGATGGCTCGGGTCACCGGCATATTTGCAACGATCAACGGCAGGCGGCTTGAATCAGAGAGCGCACCGGCACCCTTTGACGGCTCCGGTCACCGGTTCCCCTGCAACGTTCGTGGCGGTCGGCTTGGAACACACACCGCAGCGGCACCCTTTGATGGTGCGGGTCGCCGGCACACTTCAACGTTCGCGGCGGGCGGCTTGGATCACATACCGCAGCGGCACCCTTTGATGGCGCGAGTTGCCGGCACACTGGCTGACTATAAAAAGAGCTGCTACGCATTTAAAACCACGATGAACGATATGATGACTCAACTGTCTTACGATCATCGCGTAACCTTGACTGAAATGATCGGCACCATGAAATCAGAAGAAAATACGCGAGTGCGCATTGCCGATGTTTATTTTCCTACATATGACCCCGATTCTAGTACCGATGTACACGATTGGGTAGATCTTATTACACGTACTCAAGCAGAATATGGACTTCGAGATCATGAGGTACGATTAAAAGCAGCAAGTGTATTAAAAGGTCGTGCAAAGACATGGGCAGATAGTAGCCTCCTAAGGACAACAACCTGGACGGAAATGCGGGATGACATGTTGCAAACTTTCGAACCCGAATCCAGGTACTTTGCAGATATTCTGAGTTATAGAAATTACACCATTGACGAGGCAGAAAACATTCAAGATTTTATTTCAAACGTGTGGCGTATGTTCAGAAGGATAGTAAAACCTCATCCAACGGAACAGGATGCAGTAGAATTTGTCATTGGGAGCATTGGAGATGAACGGATTCGGACAGAACTGCTCAATAGCAAGTCAAATACTGTTCCGGAGTTAATTGCTATAGCCAAAACGTTTCGCAAACGAAAGAATATACCAACTAAACCGACTGAGTTCAGTAAGCAACCTCGTTTGAACTTTAATCGTGATAGATCCAACTTGACTTGTCATGTTTGTGGAAAAACAGGTCATTTTGCTGGATATTGCCCGGAAAATGCAATTCGACGTGGAACGTTTTCAGCATCAGGATCAGGAGCTTCTTTCTCATCAAGAGATTCGCCTGTACCATCCATTAAGGAGTGTTCCTACTGTAAAGGGACTCGACACACTACAGAAAGATGTTTTAAAAGAATTGCTGACGAACAACACAGAACGAAATGGATATGGACTGCCTCTCACGAAGCAACAAGATTAAACATAATCGATTACCGTACCTGCGCGCTGCTTCATACTATGTTCAAAGAGGGCGTACCAATTGAACTTCATACAGATGCAAGTGATGCTGATCCAACTATCACTCATATGAATTGGAGACTGTGGCTGTTAGACGAAGTTTTGTGCCAAAAAGTTAAGCTGGAGAATGGAAGAACCAAGACTCTAAAAGCGGTACCACAATGCTACCAATGGAGTATCATAAATAATTACCACAAAGTTTTAAAACACTTTGGCTGGGAGAAAGCACTCGAAAAACTCAAAGAACACTTTTGGTCTGACAAATTGAGCTCAAAAGTTCGCAGCTTCATAGACAATTGCGTGTACAGCATTGAACTGCACCACATCGTAGCATACACGAATAGATCAAACGGCCAGGCCAAAAGAATTTTCCGCATCGTTAAAGATGGACTCACTGTCATTAGTAATATTCAGCAGGATCACTGGAAACACAACTTGCTATTAACTGTACAGTACCTATCCAAAGCAACTGGGAAAGCACCTATGGAATGGAGCTAA
Protein
MEITKRIRTLCQRAPPAHLQRSTAGGLDHRGRRHPLMARVTGIFATINGRRLESESAPAPFDGSGHRFPCNVRGGRLGTHTAAAPFDGAGRRHTSTFAAGGLDHIPQRHPLMARVAGTLADYKKSCYAFKTTMNDMMTQLSYDHRVTLTEMIGTMKSEENTRVRIADVYFPTYDPDSSTDVHDWVDLITRTQAEYGLRDHEVRLKAASVLKGRAKTWADSSLLRTTTWTEMRDDMLQTFEPESRYFADILSYRNYTIDEAENIQDFISNVWRMFRRIVKPHPTEQDAVEFVIGSIGDERIRTELLNSKSNTVPELIAIAKTFRKRKNIPTKPTEFSKQPRLNFNRDRSNLTCHVCGKTGHFAGYCPENAIRRGTFSASGSGASFSSRDSPVPSIKECSYCKGTRHTTERCFKRIADEQHRTKWIWTASHEATRLNIIDYRTCALLHTMFKEGVPIELHTDASDADPTITHMNWRLWLLDEVLCQKVKLENGRTKTLKAVPQCYQWSIINNYHKVLKHFGWEKALEKLKEHFWSDKLSSKVRSFIDNCVYSIELHHIVAYTNRSNGQAKRIFRIVKDGLTVISNIQQDHWKHNLLLTVQYLSKATGKAPMEWS

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00098   zf-CCHC
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR001878   Znf_CCHC       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
612
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00219
Exp number, first 60 AAs:
0.00157
Total prob of N-in:
0.00215
outside
1  -  612
 
 

Population Genetic Test Statistics

Pi
286.022348
Theta
188.786366
Tajima's D
1.853288
CLR
0.060724
CSRT
0.855007249637518
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号