SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01934
Pre Gene Modal
BGIBMGA001718
Annotation
PREDICTED:_myb/SANT-like_DNA-binding_domain-containing_protein_3_[Plutella_xylostella]
Location in the cell
Extracellular   Reliability : 2.121 Nuclear   Reliability : 1.452
 

Sequence

CDS
ATGACAGCTAGTCAAAACACAAAAAAACTTTTCTGGATACAGTTAACAGAAGAATTCAATTCAATTGAATCAAATGCAAAGCGAAGTGAGGCCCAGCTCAAGAAGTGCTGGGATAATTTAAAAACACGGAGGAAGCACTTTTTAGCTAATGAAAAGCGTCAGAGAATGAAGACTGGTGGCGGACAGTGTGTTCCAAATGAGCCACAGCCTGGTAGCAGCAATGAGACCCTTATTTTTGCTGAGGTTCTACTGGATCAGATTGATGTGGAACTCAGGGGTGTCATTGACAGTGATACCATTTACAGTTCTGAAGATATTGCAATGGAGCTTGAAACATCAGTTCCAGCAGCAGCGCAACCACAACAGAATGATGAAGTTCTGAGTGAGGAATTTAAGTTTAGAAAAGAATCTTATGAAAAGAAAGAGAGAAGAGAAGATGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCAGAAGAAGTATATCTAAAAGCAAAGGCTGAGAGGGAAGCTGCAGAGGATATTAAAAAATATAATCGGGCTAAAAGAGATTGTAGTGAAAAATAA
Protein
MTASQNTKKLFWIQLTEEFNSIESNAKRSEAQLKKCWDNLKTRRKHFLANEKRQRMKTGGGQCVPNEPQPGSSNETLIFAEVLLDQIDVELRGVIDSDTIYSSEDIAMELETSVPAAAQPQQNDEVLSEEFKFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNRAKRDCSEK

Summary

Pfam
PF13873   Myb_DNA-bind_5
Interpro
IPR028002   Myb_DNA-bind_5       
ProteinModelPortal

Ontologies

GO

Topology

Length:
193
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.37376
outside
1  -  193
 
 

Population Genetic Test Statistics

Pi
283.986881
Theta
173.73342
Tajima's D
1.929147
CLR
4.537867
CSRT
0.871956402179891
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号