SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01911
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 3.179
 

Sequence

CDS
ATGGCGCAAAAAGGTAGAGAAAAACCGTATTCCCTTACGTTAGCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGACAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTCAGGAACGTAACTCTGCGCTTGCGTTCCGTCGAAGCAATGTCAGAGCTAGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCTACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTCCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCGTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAATCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCACAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTTTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCTATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGCCCCCATATAAAAACGATTGAAGAAATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACATCGCAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGACGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAGAAAAGAGTCAGCGCTCGCGGCCAATCAAATAGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCGAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAGGAAGAGCATCTTCGCGCCAAAGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACGTTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAAACACAGCGCGTCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGGAGAAAGAGTAATGCAGTCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCACCAAGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTAAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAATAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTATATGTACAACCCGGAGCTCACCAACATCACATCGGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAACCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGTTAAACACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAAAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTGTGTAAAAAGAAGAGGTGCGGAGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAACCAGCATGGCAGAAACCGAAGGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTAAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCGACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAGACAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGACCTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCACCACCTCACCGACCTCCGGCATCATTTCAAAACAAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTTGTGCACGGAGCACGCCCGGGAGGCAAGAGACAGCGCGTCAGCTTCGTGGGACACGCGACGACGGTCGACACGAACATGGACGAAGCCCTCAAACAGTACTTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACACCGAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCAACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGAGCCCGAAGATGTCCAACAATTTTAAAGCCGCAATGAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCAACGAACGAACGCACTGGTAGCGAAAGGATACGCCGAAGTAACTCCGTCGACGGGTACGAAGAAGCGAACCCGGTACTTGCCACACTTCGGCGTAACACATCCGATGAAGCAGGAGAAGATTCGCATCGTGCACGACGCCGATGCGAAAAATAGAGGGAAGAAGCCCAAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGCGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCCGCGGACATCGCGGAGATGTTCATCCAGATAGGCGTCCGAAGCGAGGACCGCGACGCACTCCGGTACTTGTGGAGGGAAAACCCTTCACGAGAACCTATAGAATACCGGATGAGGTCCATCGTCTTTGGCGCGGCAAGCTCACCTGCAACCACCATCTGCGTGAAGAACCGACTGCAGTACCCGGACGCCGCCGACCTGAAGCTCCACACACGCCCGACGGGGAGATGAGGACCTCCCTCGCCAAAGCCCGAGTCGCACCCATGAAGCCAATATCGATACCGCGTCTCGAGCTACAAGCCGCCGTGATGAGCAGCCGCATGGCCGCGGCCGTCACGGAAGAACATAATAGAAAGCCAGACACGAGAGTGTTCTGGACCGACAGCGCCACCATACAGGAGAACAGCACTGTGGAGGAATGGCGCTCGGTCCCCACAAAGGAGAATGTCGCCGACGACGCCACTAGAGAACTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGGAGTCGCGAGCGCACTTATTACAAGAGGACCAGACGGAACCCGCGCTCGGATCCGACGTGGGAGAGAAATAGAAAGAAGACAACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCTGAGACGCTCATTTGGCGACAGAGCCAGCGGGCAGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAGATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAAAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTGATCCACTACTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTCACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGTTGCATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCAGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTATGGACAAGGCGACTGAGCATGAAGCGAGCTTAAAACTTATCCAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAGCAGCCGAGGCACCCGACGCCCGAAATATTTCATACTCTGCTAGCAGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGTTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCACAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTACGCACCGCCGGCGGTATATTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGACCGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATAAAGAAACATAG
Protein
MAQKGREKPYSLTLAFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSVEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFYRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTIEEMVLTRSEKMRSSRLDRPGNEAVSGSTSQDAQQRAVSAAPRSGVTQGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNRKESALAANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQTQRVDTWLSQQRSIALQGVGERVMQSTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMLNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKRCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQDLNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGARPGGKRQRVSFVGHATTVDTNMDEALKQYFAIEGLTVAAKTPKNDPDERALKILRETTQQQPDGRYETALLWREESPKMSNNFKAAMNRLTSVEKKLEKDPNLKERYKQRTNALVAKGYAEVTPSTGTKKRTRYLPHFGVTHPMKQEKIRIVHDADAKNRGKKPKRLPAHRPGPAAVAARSDDALQAARRRRLRGHRGDVHPDRRPKRGPRRTPVLVEGKPFTRTYRIPDEVHRLWRGKLTCNHHLREEPTAVPGRRRPEAPHTPDGEMRTSLAKARVAPMKPISIPRLELQAAVMSSRMAAAVTEEHNRKPDTRVFWTDSATIQENSTVEEWRSVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTYYKRTRRNPRSDPTWERNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHYCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRALHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQAMDKATEHEASLKLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMTAAHQGGCSDVNDAARREDVRDGHKET

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0125525,     Score=98

Ontologies

Topology

Length:
2549
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.133300000000001
Exp number, first 60 AAs:
0.00169
Total prob of N-in:
0.00461
outside
1  -  2549
 
 

Population Genetic Test Statistics

Pi
281.883995
Theta
17.2459
Tajima's D
0.71783
CLR
180.986803
CSRT
0.583570821458927
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号