SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01900
Pre Gene Modal
BGIBMGA007302
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.783
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGTGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTGGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGACAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGAATGTTGAAACCGGGTAAGCAGGAAGTCATCGAGAGGGAGATGTTAAGGTGCAAAATCGACATATTGGGGCTAAGTGAAGTTCATAGAAGAGGCAGCGGTCATATAAAAACTGCTAACGGGAACATCTTGTACTTTTCGGGATCGGAAAATCATAGTGGTAATGGAGTTGCTATACTTTTACCACAGAAACTTGAAAGCAGCGTGTTAGGATACAAAACACCAAGTGATCGTATTATTGCTGTTAAACTTGATGCGCGCCCCGTACCTATCAACATTGTCCAGGTGTATGCACCAACCTCCCAATCTGAAGATATTATATCTGACCAATTCTATTTTGAATTGGATGACTTGTTGCGTACTATTCCATCTAAGGAGGTGACTGTTGTGTACGGCGATTGGAACGCGAAGGTTGGTACCACTAGAGGTGATGTATTACTCGGAGCAACAGTCGGAAACTTTGGACTTGGTGTGAGGAATGACAGAGGTGAAAAATTTCTTCAATTCTGCGTGGAAAATCAGCTGGTCATCATGAACACCTGGTTTGAACACCACCCGAGAAGGTTATATACTTGGATATCGCCATGTGGACATCGGAACCAGATTGATTATATTACCATCAAGTCTAGGTGGCGATCTTCCGTATTGAATACTAAAACACTTCCTGGTGCCGACTGCGGTAGTGACCACCAGTTGGTGGTGGCAGACTTCAGACTTCGTTTAAAAGTCATCAAGCCAAAATTTCCTATCAATATAGAACTGAATAATCCAGCGCTGGACCATTTTCATAAAACTGTAGACATGAATATACGATCAATGCTTTGGGATCCATGTGGTTCAAGTGAAGCGAACTGGAACAATCTGAAAAAGGTTGTACTGGATACGGCTAAACAAAGCAGAGATCTACACAAAGCAGTTCCTAAACATGAAGAATGGATTAGCAAGGAGTCATGGATGTTGATAGAGGAAAGGAAAAGACTAAAAGAACAAGGCATTGTAAACAATAGTCAAAGGGAGCGCTACAATCAATTGCATGCAGAGATTCAAAGGTCTACTCGGAGAGACAGAGATGAGCACATCAATAATATGTGTGAAGAAATTGAGGGACATGCTGATAAAGTGCAGACTAAGGACCTTTTCCTGAAAGTGAAGCAGCTAACAGGTGTCTTCAAGCCGAAGAAATGGATTATCGAAGATAGTAGAGGTAACACCTTGACAGAAATGGAACATGTTTTGGAGAGGTGGAGAAACTACTGTTATGAGCTATATCGCGATGAAGATAATTTATGCACCGCCAAAATATGGGATGACCACCTGGAAGAGCCTCCTATACTACTTTCTGAGGTTGAATATGCAATACAAAAACTTAAGCACAAGGTGTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIGKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGMLKPGKQEVIEREMLRCKIDILGLSEVHRRGSGHIKTANGNILYFSGSENHSGNGVAILLPQKLESSVLGYKTPSDRIIAVKLDARPVPINIVQVYAPTSQSEDIISDQFYFELDDLLRTIPSKEVTVVYGDWNAKVGTTRGDVLLGATVGNFGLGVRNDRGEKFLQFCVENQLVIMNTWFEHHPRRLYTWISPCGHRNQIDYITIKSRWRSSVLNTKTLPGADCGSDHQLVVADFRLRLKVIKPKFPINIELNNPALDHFHKTVDMNIRSMLWDPCGSSEANWNNLKKVVLDTAKQSRDLHKAVPKHEEWISKESWMLIEERKRLKEQGIVNNSQRERYNQLHAEIQRSTRRDRDEHINNMCEEIEGHADKVQTKDLFLKVKQLTGVFKPKKWIIEDSRGNTLTEMEHVLERWRNYCYELYRDEDNLCTAKIWDDHLEEPPILLSEVEYAIQKLKHKV

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1344
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.43052
Exp number, first 60 AAs:
0.05467
Total prob of N-in:
0.03320
outside
1  -  1344
 
 

Population Genetic Test Statistics

Pi
139.020828
Theta
121.805724
Tajima's D
1.951211
CLR
1.128361
CSRT
0.876006199690015
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号