SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01898
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Diaphorina_citri]
Location in the cell
Cytoplasmic   Reliability : 1.603 Mitochondrial   Reliability : 1.194
 

Sequence

CDS
ATGAAAGTTTGGGAGAAAGTGATAGAAAAGCGATTGCGAGATGAAAGTGAGATCACCCAAAACCAGTTCGGGTTCATGCCTGGTCGCGGGACAACGGACGCCATATTTGCACTCCGCCAAGTGTGCGAAAAACATCGCGACGTGCACAGGAATCTGCATATGGTGTTCGTTGATCTAGAGAAAGCGTACGACCGAGTACCTAGAGCAGTTTTGTGGTGGGCATTGAATGAGAAAGGTATACCTGGTAAGTATGTGAGGTTAATCTGTGCCATGTACAGTCGAGCCAGGACGTATGTACGAACCGCCGCGGGGAATTCCGACGAGTTCAATGTGGCAGTGGGCTTACACCAAGGGTCTGCACTAAGTCCCTATCTCTTCCTGCTTGTGATGGATGCCTTGACATCGGAGATACAGGAAGAGCCCCCTTGGTGTATGCTGTTTGCCGATGACATAGTGCTCGTCGGAGAAAACGGGCTCGAGGTCCAAAACATACTGGAGAAATGGCGATGCAAGTTGGAGAGTGTTGGCCTAAAAATCAGCAGATCGAAAACCGAACATCTGTTCTGTGATTTTGGCGGTCTCTCCAATTTTACACCCATTTCCCTCGACGGAACACCTTTGCCAGTATGTCAAGACTTCCGATACCTAGGGTCTGTTATCCAAAGCGACGGTGAACTGGATCGTACTGTCAGGCACAGAATTGACGCAGGATGGATGAAATGGCGGCAGGTCACGGGCACCATATGTGACTCGCACATCCCTCTTCCCCTAAAAGGGAAGATATATAAGACCTTAATAAGGCCTGCCGTCTTGTATGGATCAGCGTGTTGGACAACGAAAGTGGCGGATGAAAGGCGATTGCACGCAGCAGAGATGCGAATGTTGCGATGGATGTGTGGAGTAACGAGAATGGATAGAATACGGAATTAA
Protein
MKVWEKVIEKRLRDESEITQNQFGFMPGRGTTDAIFALRQVCEKHRDVHRNLHMVFVDLEKAYDRVPRAVLWWALNEKGIPGKYVRLICAMYSRARTYVRTAAGNSDEFNVAVGLHQGSALSPYLFLLVMDALTSEIQEEPPWCMLFADDIVLVGENGLEVQNILEKWRCKLESVGLKISRSKTEHLFCDFGGLSNFTPISLDGTPLPVCQDFRYLGSVIQSDGELDRTVRHRIDAGWMKWRQVTGTICDSHIPLPLKGKIYKTLIRPAVLYGSACWTTKVADERRLHAAEMRMLRWMCGVTRMDRIRN

Summary

Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
EMBL
NWSH01004369    PCG65177.1    CM000784    AQK92256.1    CM000781    AQK62700.1    + More
CM007647    ONM08550.1    AQK92235.1    AQK92238.1    CM000786    AQK46390.1    AQK97087.1    CM000780    AQK52011.1    CM007650    ONM60488.1    NCVQ01000001    PWZ55478.1    ONM11203.1    AQK92237.1    NCVQ01000008    PWZ14448.1    AQK92248.1    NCVQ01000010    PWZ06717.1    NCVQ01000004    PWZ33800.1    ONL97201.1    AQK68857.1    PQIB02000008    RLN04959.1    AQK47447.1    PQIB02000009    RLM97850.1    ONM07070.1    PWZ52216.1    CM007649    ONM29620.1    KQ484600    KYP34423.1    AQK62698.1    CM000785    AQL03708.1    CM000782    AQK86945.1    ONM02098.1    ONM55518.1    AQK70926.1    ONM33873.1    AQK50169.1    AQK43188.1    ONM52836.1    ONM38170.1    ONL92524.1    AQK84025.1    AQK92036.1    PWZ54893.1    AQK92253.1    PWZ32579.1    ONM03863.1    ONM06616.1    AQK59578.1    ONL94081.1    ONM09892.1    ONM36701.1    AQK53188.1    ONL98233.1    ONM55942.1    ONM11626.1    ONM54584.1    NCVQ01000007    PWZ18651.1    AQK78701.1    AQK98364.1    ONM32720.1    ONM06831.1    ONM55524.1    AQK78972.1    NCVQ01000006    PWZ20114.1    PWZ54982.1    AQK65817.1    NCVQ01000002    PWZ44991.1    AQK72949.1    AQK69475.1    PWZ45158.1    PWZ57036.1    AQK69444.1    MJEQ01037188    OIT01734.1    AYRZ02000001    PHT95842.1    MLFT02000001    PHT60200.1    GEDG01001285    JAP37101.1    KZ502668    PKU74657.1    KZ503407    PKU64612.1    MLFT02000036    PHT30395.1    CM007906    OTF86477.1    MLFT02000011    PHT34353.1    KZ502442    PKU79361.1    DQ070849    ABB00038.1    MLFT02000003    PHT52732.1    HQ637177    AEL30343.1    AFYH01127925    KZ452008    PKA52309.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF00083   Sugar_tr
PF05608   DUF778
PF01300   Sua5_yciO_yrdC
PF14529   Exo_endo_phos_2
PF08555   DUF1754
PF04937   DUF659
PF11894   Nup192
PF04147   Nop14
PF08711   Med26
PF12807   eIF3_p135
PF07727   RVT_2
PF08263   LRRNT_2
PF13855   LRR_8
PF00227   Proteasome
PF02213   GYF
PF12783   Sec7_N
PF09324   DUF1981
PF16213   DCB
PF01369   Sec7
PF16206   Mon2_C
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR005828   MFS_sugar_transport-like       
IPR003663   Sugar/inositol_transpt       
IPR005829   Sugar_transporter_CS       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR008496   TMEM222/RTE1       
IPR017945   DHBP_synth_RibB-like_a/b_dom       
IPR006070   YrdC-like_dom       
IPR036882   Alba-like_dom_sf       
IPR027124   Swc5/CFDP2       
IPR013865   FAM32A       
IPR007021   DUF659       
IPR012337   RNaseH-like_sf       
IPR021827   Nup186/Nup192/Nup205       
IPR007276   Nop14       
IPR035441   TFIIS/LEDGF_dom_sf       
IPR017923   TFIIS_N       
IPR033646   CLU-central       
IPR011990   TPR-like_helical_dom_sf       
IPR019734   TPR_repeat       
IPR013026   TPR-contain_dom       
IPR013103   RVT_2       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR001611   Leu-rich_rpt       
IPR013210   LRR_N_plant-typ       
IPR032675   LRR_dom_sf       
IPR011009   Kinase-like_dom_sf       
IPR017441   Protein_kinase_ATP_BS       
IPR029055   Ntn_hydrolases_N       
IPR001353   Proteasome_sua/b       
IPR003169   GYF       
IPR035445   GYF-like_dom_sf       
IPR032629   DCB_dom       
IPR015403   Sec7_C       
IPR000904   Sec7_dom       
IPR032817   Mon2_C       
IPR016024   ARM-type_fold       
IPR032691   Sec7_N       
IPR023394   Sec7_C_sf       
IPR035999   Sec7_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF103473   SSF103473       
SSF55821   SSF55821       
SSF82704   SSF82704       
SSF53098   SSF53098       
SSF48452   SSF48452       
SSF56112   SSF56112       
SSF56235   SSF56235       
SSF55277   SSF55277       
SSF48371   SSF48371       
SSF48425   SSF48425       
PDB
6AR3     E-value=6.98005e-05,     Score=109

Ontologies

Topology

Subcellular location
Nucleus  
Length:
309
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06904
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.15270
outside
1  -  309
 
 

Population Genetic Test Statistics

Pi
52.850589
Theta
32.635864
Tajima's D
1.409275
CLR
0.93927
CSRT
0.773711314434278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号