SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01894
Pre Gene Modal
BGIBMGA005944
Annotation
PREDICTED:_serine/threonine-protein_phosphatase_1_regulatory_subunit_10-like_isoform_X2_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.963
 

Sequence

CDS
ATGTCCAGCATAGAACCAAAACAACTTCTTGGGTGCCTTAGTGGACTTCTTTCTAATAATGGTGGCATTAAACGCAGAAACGAAGTCCAAAGGATTGCACGTCTTATGTCTAAATATTCTAAGAAATTAGTATCTAAATGTATCTACATACAAATTCTGAAGTGTACAGAAACTGAACTATTGGATTTGTTCATGAGGTATAATGGATGGCTTTTAATTCACTTATGGTTAACAGAAAGCATAGTAGCAAAAAACTGGCCTCTTGTGAAAGAATTACTGGAGTTATTGTTGTTGTGTCCTGTCGACTTAAATCGACTTAAAACTAATAATTGTCCAAAACTCGTTAAAGAATTATCTAAGGATGGAGATCACTTTGCTATTAGAGCACTGGCTTCAAAACTGGTTGAGCAATGGTTAAAAACTGTACAAGGAGAAAAAGTAGTTCCTGTTTTACTGTCTGATATTCCTCAGATAATTAGTGATGGCAACGGTGAAATAAAACCGGAGATAGTTAAACTAAAATCTGAGGTAGAACAAGCAAAAGATACTGCAGAAAATGAAGAGAGTACTGTTAAAACTGTTAAAACTGAGGAATGCTGCAAGAGTGAAAGTATAGAAATAACGCCCACAGTTAAGGAAGAAAACCAAGAACCTTCCAAAACTGAAATCAAAATAGAAACAGACCAACAACTTGAGACTTTGCCTGTCCTTAAAATTAGTTTAAAAGATGGTGTTCAAACAGTGTTGAAAGTTGAAGATACTGAAAACAAAGATTTGAAAGAATCCCCAACCAGTGAAAAGTTGAAAGAAAACTCCAAAAATAAAGATAAAGATAAATCGAGTGAGAAAACCAAAAGTAGTCACACGAAATCAAATAGTTCGAAACATTCGAGTAAAGCACGTTCTTCGAGTGATAAACATAAGAGTAGCAGCAGCTCTAGTCGACACAGTAGTAGCAAGGACAAGAAAAAAGATAAGGATAAGGATAGAAGTTCTCATAGTTCTAAATCTAAAAGTGATAGTAGTAAGAAATCATCCAGTAGTAGTAGTAGTAGTAATAGTAGTAGTAGTAGTAAAACAAAAGATGATCGTAGCACTAAAAATTCTGAAAAAGAGAAAAGAGAGAAAGATGAGAAACTTGGTAAGAAAAAAGATAAAGACACAAAAGAAAAATCGGATGAAAGTAATGAACATAAGACACCTTCAATATCGAAGCTAGGAAAAATTCCAAAGCTTAGTGATTTAAAAAAGGAAAAGCCTTCTATATCAATAGAAGTGAGAAAGCCTGACGATCCAAAACCGAAAACTGTAAAAGCTTACAATTCAAAATTTAGGAAACATGGATTGGAGGAGGAGATAAAACCGCCGCCATCGCGCTCTGTACTATTAAATAAAAAAGCACCACCACCACCCATACCTCCCATAGTCTCTATACCGAAAAGACATTCTCCAGTACATAATGAAACACCACCTGAAAAGAAACTTAAAACTATGGAAATAGTAGAAAAACCTGGTTCTATTAAATTAATACCTCCCAAACCAAAACCCATGACACTTTTGGAAAGCGATATGTTTATGGATGCACTCAATGCTTCAGCGACAAATAAGAAGGAACCAAAGAAAAGAAAAAGGCGTACGAGCGGATCGAAGGATGGCAATCCTAATGACGGATCACCTCCACCTACACCGACATCACTCAGTAGTCCCACAAGCGAAAGTAAATCTGTACCGCCAAGGTTTTACCAAGATACTTTGGATGCAGAAGAACGTAAAGACAAAAGTCATGAAAGTAAAGAACCAGTTAGTCCCGTGACCACAGAAAATGAAGTCGAAGACGACAAGATGGACGTTTCTGGGCCGCATACATTAACAGTTAATGGATTAAAAGGGGTTTTATGTTATCATAGAAAAAAAGGTCCCAAAAAGAACATTAAATGGAAACCTGACAGTGAACTAGAAACAATTCATGTATTTGACCTGGATGAGACTGAAAGAATAAATGTCACCAAAACATTCACGGATATGAAATATTTAGAAAGAATACACGAAAGGGAAGCTTTCGAAAAAGCAAGAAACCTTAGTAATGACGACGTTATGGAAGAACGTACAAATTGGAAGCCTTTGATTTTAGTAGATTTAGAAGGACAATTACAAGTAGATTATGGCAAAAACAGTAAAGAGAAAGATATACAGGCACTACGACAAAAAGTAACCTTACAACCTTTATATTTCAACAAGGCAATGATTCCTGATTCCCCAATTGAACCAGAATTAGAAACTCACACCTATTCTGAACCCTCAATAATTCCCTTGGAAGATGTCACTGGAAATCAAGATAATATAAGTGATTTTAGAAATATGCCTTGGCCTGAACCGAGAGGTAATGCTCCACCCCAAACACCGAGTAATATGACTGTTGGTGCTAGTCCATTATTCCCTAACAATCTCACACAATTTTCAAACACTTTTCCTAATACGCAATTTCCTGGAGTACCACCTGCCTTCCAAGGCCCTAACATCGTTCCTGGTGAGTGGCAAAATGGAATACCCCAACAGATGATACCAAATGGAATGCCTGGTCCAATAGGAACCCACAATTTAGCACCAGGTGTGATGCCTCCCGGAAGCCATCCACAAGGTATGATGATTTCACCTGAGACTATGATGATGGCTCCGGAGATGTTCGGAAACCCAACTCCAATGATTCCTGTACCACCGGAAAGTTTCAATATGCAACAGAATATGTATCCGATGGATTTCAACATGGTAGGTCCTCCGGGACCGGGCCCCGAAGGTTTTAATGGCCCTGGCCCTGGTTCTGGTCCCGGACCTGGTAATTTTAGAGGAGCCATGCGTGGTCGCGGTGTCAATGGTCATTGGCGCGGAAAGGGTGCGGGGAACTGGGAAAATCCGTCCAGGGGTGGTAGAGGAGGAGGCCCTCGCGGGAACCGAAAGACAATTTGTATGTATTTTCAAAGGAAGGGATCTTGTCGGCAGGGCGATAATTGTACATTCTTGCATCCAGGTGTGAACTGTCCTTTTTAA
Protein
MSSIEPKQLLGCLSGLLSNNGGIKRRNEVQRIARLMSKYSKKLVSKCIYIQILKCTETELLDLFMRYNGWLLIHLWLTESIVAKNWPLVKELLELLLLCPVDLNRLKTNNCPKLVKELSKDGDHFAIRALASKLVEQWLKTVQGEKVVPVLLSDIPQIISDGNGEIKPEIVKLKSEVEQAKDTAENEESTVKTVKTEECCKSESIEITPTVKEENQEPSKTEIKIETDQQLETLPVLKISLKDGVQTVLKVEDTENKDLKESPTSEKLKENSKNKDKDKSSEKTKSSHTKSNSSKHSSKARSSSDKHKSSSSSSRHSSSKDKKKDKDKDRSSHSSKSKSDSSKKSSSSSSSSNSSSSSKTKDDRSTKNSEKEKREKDEKLGKKKDKDTKEKSDESNEHKTPSISKLGKIPKLSDLKKEKPSISIEVRKPDDPKPKTVKAYNSKFRKHGLEEEIKPPPSRSVLLNKKAPPPPIPPIVSIPKRHSPVHNETPPEKKLKTMEIVEKPGSIKLIPPKPKPMTLLESDMFMDALNASATNKKEPKKRKRRTSGSKDGNPNDGSPPPTPTSLSSPTSESKSVPPRFYQDTLDAEERKDKSHESKEPVSPVTTENEVEDDKMDVSGPHTLTVNGLKGVLCYHRKKGPKKNIKWKPDSELETIHVFDLDETERINVTKTFTDMKYLERIHEREAFEKARNLSNDDVMEERTNWKPLILVDLEGQLQVDYGKNSKEKDIQALRQKVTLQPLYFNKAMIPDSPIEPELETHTYSEPSIIPLEDVTGNQDNISDFRNMPWPEPRGNAPPQTPSNMTVGASPLFPNNLTQFSNTFPNTQFPGVPPAFQGPNIVPGEWQNGIPQQMIPNGMPGPIGTHNLAPGVMPPGSHPQGMMISPETMMMAPEMFGNPTPMIPVPPESFNMQQNMYPMDFNMVGPPGPGPEGFNGPGPGSGPGPGNFRGAMRGRGVNGHWRGKGAGNWENPSRGGRGGGPRGNRKTICMYFQRKGSCRQGDNCTFLHPGVNCPF

Summary

Pfam
PF08711   Med26
Interpro
IPR000571   Znf_CCCH        + More
IPR035441   TFIIS/LEDGF_dom_sf       
IPR017923   TFIIS_N       
IPR036855   Znf_CCCH_sf       
IPR003617   TFIIS/CRSP70_N_sub       
SUPFAM
SSF90229   SSF90229        + More
SSF47676   SSF47676       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1014
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02123
Exp number, first 60 AAs:
0.00139
Total prob of N-in:
0.00101
outside
1  -  1014
 
 

Population Genetic Test Statistics

Pi
256.727023
Theta
204.124551
Tajima's D
0.765656
CLR
0.108598
CSRT
0.590070496475176
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号