SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01864
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.167
 

Sequence

CDS
ATGGCTATACTATACATACACCTGCGACACGCAACGTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTTCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAAGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MAILYIHLRHATYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISFRIRRRNLTPPITLFRQPIPWAKKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

EMBL
U07847    AAA17752.1    KC165845    AFY12622.1    AB018558    BAA76304.1    + More
AB055391    BAB21761.1    KQ459259    KPJ02068.1    KQ459580    KPI99178.1    AF081101    AAC72919.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    GALX01005300    JAB63166.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GGMR01019198    MBY31817.1    GGMS01004685    MBY73888.1    ABLF02042518    ABLF02057746    ABLF02008933    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KK113014    KFM59099.1    GBBI01004571    JAC14141.1    ABLF02019349    ABLF02041900    KK117880    KFM71667.1    GEZM01038405    JAV81653.1    GFTR01008038    JAW08388.1    GGMR01016114    MBY28733.1    ABLF02066620    NEVH01012084    PNF30905.1    GFXV01000774    MBW12579.1    KK113137    KFM59425.1    ABLF02033757    GGMR01003407    MBY16026.1    NEVH01000598    PNF43535.1    GGMS01000737    MBY69940.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    ABLF02008463    NEVH01016327    PNF25684.1    NEVH01020940    PNF20481.1    GBBI01001693    JAC17019.1    ABLF02008153    ABLF02008462    ABLF02008464    LBMM01013518    KMQ85605.1    NEVH01006721    PNF37225.1    NWSH01000032    PCG80497.1    GBBI01004395    JAC14317.1    NEVH01026386    PNF14434.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    NEVH01002704    PNF41489.1    AF012049    AAC24972.1    NEVH01020963    PNF20308.1    LBMM01014395    KMQ85192.1    NEVH01003017    PNF40781.1    NEVH01000269    PNF43694.1    GGMS01008766    MBY77969.1    NEVH01006736    PNF36716.1    NEVH01010546    PNF32261.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01020071    PNF21969.1    NEVH01021205    PNF19912.1    GGMR01000676    MBY13295.1    GGFJ01001857    MBW50998.1    GGMS01012005    MBY81208.1    GGMR01004661    MBY17280.1    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    GBBI01001692    JAC17020.1    PCG80496.1    LBMM01018951    KMQ83660.1    GEZM01053022    JAV74219.1    KK116158    KFM66983.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01023961    PNF17613.1    NEVH01016302    PNF25823.1    GGFJ01001858    MBW50999.1    RPOV01000134    RPJ78669.1    NEVH01000280    PNF43672.1    GGMR01016296    MBY28915.1    NEVH01017542    PNF24034.1    GGMS01017914    MBY87117.1    NEVH01007838    PNF34986.1    NEVH01014858    PNF27387.1    NEVH01011985    PNF31054.1    NEVH01006754    PNF36554.1    NEVH01019964    PNF22161.1    GGMR01018716    MBY31335.1    NEVH01002716    PNF41415.1    NEVH01017470    PNF24199.1    S59870    AAB26437.2    ABLF02020655    ABLF02039168    ABLF02061060    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01007841    PNF34974.1    NEVH01017559    PNF23833.1    NEVH01019376    PNF22596.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
450
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.640789999999998
Exp number, first 60 AAs:
0.01952
Total prob of N-in:
0.03054
outside
1  -  450
 
 

Population Genetic Test Statistics

Pi
47.355606
Theta
64.598943
Tajima's D
0.956584
CLR
0
CSRT
0.652767361631918
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号