SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01863
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.856
 

Sequence

CDS
ATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGCGGGAAAAAAATATCGGGAAATTCTTTTTTCGGATGAAAAAATTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCGTGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGTCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MGLSRTTVKRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRYAGKKYREILFSDEKIFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLVVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWSRRLKACIQNHGGHFE

Summary

EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB473770    BAH20555.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    U47917    AAB47739.1    JF779677    AEO90418.1    KQ459680    KPJ20472.1    LNIX01000030    OXA41211.1    JOJR01000583    RCN36166.1    JOJR01000015    RCN51257.1    CAVP010059404    CDL95787.1    JARK01001345    EYC27589.1    UYSL01019905    VDL71189.1    JARK01000176    EYC41234.1    JARK01001411    EYC06502.1    JARK01000059    EYC44525.1    JARK01001601    EYB87313.1    JARK01000255    EYC39473.1    DS268747    EFP00909.1    JARK01001658    EYB84158.1    PDUG01000005    PIC23776.1    JARK01001418    EYC05389.1    DS268565    EFO90304.1    DS268539    EFO88027.1    PDUG01000006    PIC20538.1    DS268492    EFP11689.1    PDUG01000001    PIC53815.1    JARK01001337    EYC34439.1    DS268428    EFO94379.1    DS268673    EFO98001.1    LFYR01002220    KMZ56176.1    DS268508    EFO83264.1    UZAH01001595    VDO19836.1    DS268421    EFO88618.1    PDUG01000012    PIC13506.1    UYSL01019770    VDL69590.1    DS268612    EFO94085.1    DS268679    EFO98285.1    PIC28734.1    DS268466    EFP06959.1    DS268525    EFO85497.1    HE601413    CAS00486.1    HE601187    CAR99265.1    DS268545    EFO88382.1    KX931010    APL98300.1    PIC29926.1    DS268606    EFO93488.1    HE601047    HE600964    CAS00660.1    CAS01013.1    HE601437    CAR99651.1    PIC51673.1    HE601507    CAR99239.1    EFP11674.1    UZAH01029309    VDP05368.1    UYSL01020440    VDL74616.1    HE600908    CAR99632.1    UZAH01027257    VDO90094.1    PDUG01000004    PIC32571.1    PDUG01000003    PIC39650.1    JARK01001499    EYB95145.1    PIC22722.1    PIC39649.1    KA646003    AFP60632.1    DS268623    EFO94692.1    HE601401    CAR99806.1    CAS00634.1   
Pfam
PF13358   DDE_3        + More
PF00292   PAX
PF10320   7TM_GPCR_Srsx
Interpro
IPR009057   Homeobox-like_sf        + More
IPR038717   Tc1-like_DDE_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR019424   7TM_GPCR_Srsx       
SUPFAM
SSF46689   SSF46689       
Gene 3D
PDB
5CR4     E-value=2.92222e-09,     Score=145

Ontologies

Topology

Length:
255
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.47518
Exp number, first 60 AAs:
0
Total prob of N-in:
0.15033
outside
1  -  255
 
 

Population Genetic Test Statistics

Pi
67.880487
Theta
69.985046
Tajima's D
0.31557
CLR
0.685613
CSRT
0.458877056147193
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号