SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01859
Pre Gene Modal
BGIBMGA006187
Annotation
putative_fatty_acid_transport_protein_FATP2_[Spodoptera_litura]
Location in the cell
Nuclear   Reliability : 2.499
 

Sequence

CDS
ATGAGCACGTCCACGCGCGTCGGTTGCTCAAATCGGAATGGTGATGACGTTTTACACAAAACATGCCTTTTTATACCTGCAGTTGGTCTTGCAAACTGCAGTGAGTTGAGGGAGCAATTTTTGGAGTTTGCTGTTGTCGTTTTGTTTCAGCAGGCAGGTAAACTTATCATGTCTTATGTGGTGGAAGATTACAGCTTACGTGTAACAGCGGTTTTGAAATCGCAAGGCGTTAAGAAAGGAGACATTGTTGGTCTCCTTTTCAACAATTGTCCCCAGATGCCGGCTGTATGGATGGGTATAGCCCGTCTCGGCGGCGTTGCACCTCTGATTAATACGAATCAGAGAGGCAACGCTTTATTGCATTCCATAAACGTCGCTAAATGCGATTATTTGATATTTTCCGACGAGTATCAATCAGCCGTTCAAGACGTAGCGGGTCAATTGAGTCCGTCATTAAAACTTTACAAATTCACTCACCGCGACCTGAACAGTTCGAGCGGAAAGTCTGGGGAGGGCGGCGACGCGATCCAAGATTTTACAAACTTATTGGAAACGACGCCGCCTGCGACTTGGACGTTGGCTGACGGAGAGGGATTCGAAGGCAAACTGCTGTATATATATACGTCCGGAACTACAGGGCTTCCTAAGGCAGCTGTTATATCGAATGCGAGGTTCGTATTCATGGCAGCGGGTATCCACTTCTGGCGTCTCAATTCTTCAGATATCATATATTGTCCGCTGCCTTTATACCACACAGCGGGAGGAGTGATCAGCGTGGGCCAAGCACTGATTCTTGGATGTACAGTCGTATTGAAAGCTAAGTTCTCAGCTTCGCAATACTTCCCTGATTGTGCGAAATATAACGCTACGGCCGCCCACTACATAGGCGAGATGTGTCGTTATGTCCTAGCGACGCCGCCGTCGCCCGCCGACACGCAACACAACGTGCGCGTCATCTACGGGAACGGACTAAGGCCACAAATATGGACGGAGTTCGTAAAAAGATTTAATATTAAATATGTAACGGAGTTTTACGGGGCAACAGAAGGCAACGCTAATATAGCGAACACTGATGGTACTCCAGGAGCCATTGGCTTTGTGTCACGGATCATTCCGAGAGTTTATCCGATCGCCATCATCAAAGTAGACCAAGAGACAGGAGAACCGATAAGGGACCAGAAAGGCCTTTGTCAGTTGGCCGAGCCGAACGAGCCGGGCGTGTTCATCGGTAAGATCCAGACGCGGAATCCGGCGCGCCAGTTCCTCGGCTACGTCGATAAATCCGCGTCCGAGAAGAAAATCGTCAGGGACGTGTTTGAGCATGGCGATTCTGCCTTTATATCCGGCGACATCCTGGTGGCGGACGAATTAGGTTATCTGTACTTCCGCGACCGCACCGGAGACACGTTCCGGTGGCGCGGAGAGAACGTCTCCACCACAGAGGTCGAGGCGGCCGTGTCTAGATGTGCCGACCATAGAGACGCCGTTGTCTATGGCGTATTGGTGCCGAATATCGAAGGTCGGGCGGGTATGTGCGGGCTGGTGGACGCGGCGGGCACGCTGGACCTGCGCGCGCTGCACGAGCGTCTGGCGCGCGACCTGCCCGTCTACGCGCGACCAGTCTTCATGAGGATCATGGACAGCGTCGATATGACCGGCACATTTAAGATGAAAAAGACTGATCTCCAAAAGGAAGGTTTCGACCCGGCTTTGGTGAAGAAAGACAAACTTTACTATTTAGATCCGAAATTGGGACAGTATCTGCCCCTGGGGAAAGAGGAATACGAGAAAATCGTCAGCGGACAAATCAGGCTGTGA
Protein
MSTSTRVGCSNRNGDDVLHKTCLFIPAVGLANCSELREQFLEFAVVVLFQQAGKLIMSYVVEDYSLRVTAVLKSQGVKKGDIVGLLFNNCPQMPAVWMGIARLGGVAPLINTNQRGNALLHSINVAKCDYLIFSDEYQSAVQDVAGQLSPSLKLYKFTHRDLNSSSGKSGEGGDAIQDFTNLLETTPPATWTLADGEGFEGKLLYIYTSGTTGLPKAAVISNARFVFMAAGIHFWRLNSSDIIYCPLPLYHTAGGVISVGQALILGCTVVLKAKFSASQYFPDCAKYNATAAHYIGEMCRYVLATPPSPADTQHNVRVIYGNGLRPQIWTEFVKRFNIKYVTEFYGATEGNANIANTDGTPGAIGFVSRIIPRVYPIAIIKVDQETGEPIRDQKGLCQLAEPNEPGVFIGKIQTRNPARQFLGYVDKSASEKKIVRDVFEHGDSAFISGDILVADELGYLYFRDRTGDTFRWRGENVSTTEVEAAVSRCADHRDAVVYGVLVPNIEGRAGMCGLVDAAGTLDLRALHERLARDLPVYARPVFMRIMDSVDMTGTFKMKKTDLQKEGFDPALVKKDKLYYLDPKLGQYLPLGKEEYEKIVSGQIRL

Summary

EMBL
BABH01004926    KT261735    ALJ30275.1    NWSH01000026    PCG80607.1    KU755520    + More
ARD71230.1    KQ459601    KPI93923.1    AGBW02012128    OWR45591.1    AB451529    BAG68297.1    KU755519    ARD71229.1    ODYU01006048    SOQ47558.1    KZ150176    PZC72567.1    PCG80606.1    KT261734    ALJ30274.1    OWR45592.1    AB561867    BAJ33525.1    AB561865    BAJ33523.1    AB561866    BAJ33524.1    KPI93924.1    KF960750    AII21952.1    ODYU01008570    SOQ52285.1    BABH01004921    BABH01004922    GEYN01000119    JAV02010.1    GAPW01000350    JAC13248.1    JXUM01037594    KQ561134    KXJ79609.1    JXUM01001108    JXUM01001109    KQ560116    KXJ84416.1    DS231954    EDS28847.1    KA646525    AFP61154.1    GEZM01057722    JAV72118.1    GFDL01005560    JAV29485.1    GFDL01002084    JAV32961.1    GDKW01002815    JAI53780.1    ACPB03008862    JRES01001167    KNC24896.1    GANO01002398    JAB57473.1    GBYB01004241    GBYB01004242    JAG74008.1    JAG74009.1    NEVH01013990    PNF27940.1    GL436457    EFN71922.1    GECL01003465    JAP02659.1    CH940649    EDW64198.1    LJIG01002618    KRT84322.1    AJWK01021905    AJWK01021906    AJWK01021907    AJWK01021908    AJWK01021909    AJWK01021910    AJWK01021911    GAKP01020344    JAC38608.1    GAKP01020345    GAKP01020341    JAC38611.1    NNAY01000564    OXU27644.1    CH477196    EAT48382.1    GAKP01020346    GAKP01020342    JAC38610.1    GDHF01005924    JAI46390.1    KQ971343    EFA03519.2    GAMC01014421    GAMC01014420    JAB92135.1    GBGD01000764    JAC88125.1    CH954177    EDV59020.1    KQS70597.1    CH963857    EDW76632.1    CP012523    ALC38091.1    CM000361    CM002910    EDX04566.1    KMY89572.1    GL451657    EFN78828.1    ALC40362.1    CM000157    EDW87952.1    KRJ97506.1    ALC40350.1    CH480818    EDW52460.1    CH933807    EDW12738.1    CH902620    EDV32368.1    GBBI01002688    JAC16024.1    KB632364    ERL93540.1    GBHO01023418    JAG20186.1    CH379061    EAL33103.3    CH479189    EDW25471.1    GDHC01003326    JAQ15303.1    PNF27941.1    APGK01037735    KB740948    ENN77457.1    CH940648    EDW60625.2    KRF79516.1    AE014134    ACZ94228.3    AY052105    AAF52969.2    AAK93529.1    AAN10757.1    AGB92889.1    CH916368    EDW03613.1    GBXI01008652    JAD05640.1    GGFM01004615    MBW25366.1    KQ976745    KYM75463.1    CH916367    EDW00615.1    KZ288325    PBC27997.1    AAAB01008987    GFDF01002506    JAV11578.1    GFDF01002651    JAV11433.1    GFDF01002628    JAV11456.1    OUUW01000006    SPP81790.1    SPP81791.1    CH902619    KPU76959.1    KPU76960.1    EAA01228.5    KQ982014    KYN30653.1   
Pfam
PF13193   AMP-binding_C        + More
PF00501   AMP-binding
PF06417   DUF1077
Interpro
IPR020845   AMP-binding_CS        + More
IPR042099   AMP-dep_Synthh-like_sf       
IPR000873   AMP-dep_Synth/Lig       
IPR025110   AMP-bd_C       
IPR030304   FATP4       
IPR009445   TMEM85/Emc4       
Gene 3D
PDB
4FUQ     E-value=4.28412e-17,     Score=217

Ontologies

Topology

Length:
605
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.14483000000001
Exp number, first 60 AAs:
0.08433
Total prob of N-in:
0.04986
outside
1  -  605
 
 

Population Genetic Test Statistics

Pi
180.795452
Theta
145.939604
Tajima's D
0.832706
CLR
0.854862
CSRT
0.610269486525674
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号