SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01857
Pre Gene Modal
BGIBMGA006185
Annotation
fatty_acid_transport_protein_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.675 Nuclear   Reliability : 1.883
 

Sequence

CDS
ATGAAACCCGGTGCTGTTGACATCGAAAAAAGCAAACAGAACAGTGATTCGGATGGAGTGTCTTGGGGAAAAATATTTTACGTGTTGCTGTCGCTAGCAGTTATCGTGATAGCCTGTGGCGTCGCCTGGGTGTTCCAGGACTGGCTCACCAGTCTTATCATCTTCGTTGTACTTTTGGTGGTATTCACCGTTGGCTATTTCTGGAAATGGCTGTACATCGCGGCCAGAACTGCTCCTAGAGATTTTTCGGCACTGTGGTGTTATGTTAAAATCCTGAGACTTTCGGGTAATTTTGGTAAGAAGAACTGGTCAATGCCCGATATATTCCATGAAAATGTAAAGAGACATCCGAACAAAGCATGCTTCCTTTACGAGAACGAGTCATGGTCCTTTAAACAGGTCGAAGAATTCAGTCTTCGTGTTACGGCAGTGCTTAAGAATCATGGTGTGAAACGTGGAGATGTTGTCGGCGTAATGATGAATAACTGTCCGGAATTGCCGGCGACGTGGCTAGGCGTAGCTCGCATGGGAGGCGTGTCGCCTCTCATAAACACGAACCAAACCGGAAACGCTCTTCTGCATTCGGTTAACGTTGCGAAATGTAACGTTGTGATATACGGAAGCGAGTTTCAGAGTGCATTCGATGAAATATCAAATGAAATAAATCCCGCAATAAAACTGTATAGATACAACCGGAGACCCCTAAATGCATCAGGTGATGCTGTTAGGGTTGTAGAATCGGAAAACGATTTCACTCATATGTTGGAGACTACACCTCCTGCCCCGTGGAGTCTTTCCGACGGAGAAGGCTTCACCGGAAAACTTCTATATATATACACGTCAGGGACTACTGGATTGCCCAAAGCAGCAGTTATATCTCCGTCAAGGATGGTGTTCATGGCATCGGGCGTACATTATTTAGGTGGATTGAGAAAAAACGATATAATGTACTGTCCAATGCCTTTGTATCATTCAGCTGGAGGGTGTATTTCAGTTGGTCAGGCCTTCATATTCGGGTGCACTGTAGCTTTGAGAGCGAAATTTTCGGCGTCTGCATATTTCCCGGATTGCATTAAATTCAAAGCAACGGCCGCTCACTACATTGGGGAGATGTGTCGGTATATCCTAGCAACACCTCCGTCCGCAACTGACAGGCAACACAAAGTTCGAACCGTATACGGCAATGGAATGAGGCCAACCATCTGGACAGAATTCGTCAAACGCTTCAACATCAAACGTGTCGTCGAGTTTTATGGCGCAACAGAAGGCAACGCAAATATCGTAAACATCGACAACAAGACAGGTGCAATAGGATTTGTATCGAGAATCATCCCCGCAGTTTACCCGATAGCGATTCTCAAGGTTGATCAAGAAACTGGCGAACCAATCAGGAATTCCAAAGGACTTTGCCAGCTAGCAAAGCCGTATGAGCCAGGAGTATTTATTGGCAAGATTAAACCTAACAATCCATCAAGGGCGTTCCTGGGTTACGTGGACAAAGAAGCATCTGAGAAGAAAATAGTTAGAGACGTATTTAACATCGGCGATTCTGCGTTTATATCAGGTGACATCCTGGTGGCGGACGAATTAGGTTATCTGTACTTCCGCGACCGCACCGGAGACACGTTCCGGTGGCGCGGAGAGAACGTTTCCACCACAGAGGTCGAGGCGGCCGTGTCTAGATGTGCCAATCAAAGGGACGCTGTAGTCTACGGTGTAGAGATTCCGAATACGGAAGGTCGGGCTGGCATGTGCGGCATAGTGGACATTGAAGGCACATTGGACCTGGATAAACTCGCCAAAGATATTGCGAAAGACCTGCCTAAATACGCGAGGCCAATATTCATTAGAATAATGACCAGCGTTGATATGACAGGAACATTCAAAATGAAGAAAGTGGATTTACAAAAAGAAGGTTATAATCCATCAACTGTGAGCGACAAAATGTTCTTCTTTGAACCAAAACAGAATAAGTACGTGCCCTTAGGAGTTGAAGAATACGAAAAGATTATATCTGGCGCTACGCAGCGCTGCGTTTCGAACTTGCTTTCCACAGGTCGTCGCTCTTCAGTTCGTCGCCTCTCGTTACGAAAGTTAGTCGCGACGATGATAGCCCTTGCCGTCGCCGCCGGTGTGTTCGCAGCCGCTTGGCTCAACATAGGTTTCTATTATTCTCTCACAGCTTCCGTGCTTCTGGTTGTTCTATATTTGATACTCGTTCAGAAAAAATTCTGCTACGTGGCGATAAAAACGATTCCACGGGATGTAAAGGCATTATACACATACATACAGATATTATGGATAACTCGAAAGTTCAGCAAGTTGAATCTCACTGTACCAGATATATTTCATGACACAGTGCAAAAGCATCCAGATAAAGCATGTTTCTTATTCAAGGATGAAGTATGGACATTTAAAGAGAACACCTCAGTTGGCCTGCCCCGGCGTGACACGAATCTGCCAAATGTCATGAGGAAAGCGTCTTTCTAA
Protein
MKPGAVDIEKSKQNSDSDGVSWGKIFYVLLSLAVIVIACGVAWVFQDWLTSLIIFVVLLVVFTVGYFWKWLYIAARTAPRDFSALWCYVKILRLSGNFGKKNWSMPDIFHENVKRHPNKACFLYENESWSFKQVEEFSLRVTAVLKNHGVKRGDVVGVMMNNCPELPATWLGVARMGGVSPLINTNQTGNALLHSVNVAKCNVVIYGSEFQSAFDEISNEINPAIKLYRYNRRPLNASGDAVRVVESENDFTHMLETTPPAPWSLSDGEGFTGKLLYIYTSGTTGLPKAAVISPSRMVFMASGVHYLGGLRKNDIMYCPMPLYHSAGGCISVGQAFIFGCTVALRAKFSASAYFPDCIKFKATAAHYIGEMCRYILATPPSATDRQHKVRTVYGNGMRPTIWTEFVKRFNIKRVVEFYGATEGNANIVNIDNKTGAIGFVSRIIPAVYPIAILKVDQETGEPIRNSKGLCQLAKPYEPGVFIGKIKPNNPSRAFLGYVDKEASEKKIVRDVFNIGDSAFISGDILVADELGYLYFRDRTGDTFRWRGENVSTTEVEAAVSRCANQRDAVVYGVEIPNTEGRAGMCGIVDIEGTLDLDKLAKDIAKDLPKYARPIFIRIMTSVDMTGTFKMKKVDLQKEGYNPSTVSDKMFFFEPKQNKYVPLGVEEYEKIISGATQRCVSNLLSTGRRSSVRRLSLRKLVATMIALAVAAGVFAAAWLNIGFYYSLTASVLLVVLYLILVQKKFCYVAIKTIPRDVKALYTYIQILWITRKFSKLNLTVPDIFHDTVQKHPDKACFLFKDEVWTFKENTSVGLPRRDTNLPNVMRKASF

Summary

EMBL
AB451529    BAG68297.1    BABH01004921    BABH01004922    KZ150176    PZC72567.1    + More
NWSH01000026    PCG80606.1    AB561865    BAJ33523.1    KU755519    ARD71229.1    ODYU01006048    SOQ47558.1    KT261734    ALJ30274.1    AB561866    BAJ33524.1    AGBW02012128    OWR45592.1    KQ459601    KPI93924.1    GEYN01000119    JAV02010.1    PCG80607.1    KT261735    ALJ30275.1    KU755520    ARD71230.1    OWR45591.1    KQ460855    KPJ11959.1    GL436457    EFN71922.1    KQ971343    EFA03519.2    KQ982014    KYN30653.1    KQ978456    KYM93879.1    GFDL01005560    JAV29485.1    GFDL01002084    JAV32961.1    KQ976745    KYM75463.1    GAPW01000350    JAC13248.1    ADTU01022742    ADTU01022743    JXUM01001108    JXUM01001109    KQ560116    KXJ84416.1    KA646525    AFP61154.1    AJWK01021905    AJWK01021906    AJWK01021907    AJWK01021908    AJWK01021909    AJWK01021910    AJWK01021911    JRES01001167    KNC24896.1    CH477196    EAT48382.1    KQ982409    KYQ56708.1    GANO01002398    JAB57473.1    NEVH01013990    PNF27940.1    GFDF01002628    JAV11456.1    GFDF01002506    JAV11578.1    GFDF01002651    JAV11433.1    GL451657    EFN78828.1    DS231954    EDS28847.1    CH940649    EDW64198.1    GAKP01020345    GAKP01020341    JAC38611.1    PNF27941.1    GL887844    EGI69837.1    GL766616    EFZ14911.1    GAMC01014421    GAMC01014420    JAB92135.1    KZ288325    PBC27997.1    CH963857    EDW76632.1    GBYB01004241    GBYB01004242    JAG74008.1    JAG74009.1    AXCM01004450    ADMH02002183    ETN57977.1    AAAB01008987    GGFM01004615    MBW25366.1    EAA01228.5    GBXI01008652    JAD05640.1    AXCN02000314    GEDC01019541    JAS17757.1    JXUM01037594    KQ561134    KXJ79609.1    CH902620    EDV32368.1    CH933807    EDW12738.1    KB632364    ERL93540.1    NNAY01000564    OXU27644.1    QOIP01000011    RLU17248.1    APGK01037735    KB740948    ENN77457.1    KK107183    EZA55891.1    GBBI01002688    JAC16024.1    CH916368    EDW03613.1    GDKW01002815    JAI53780.1    CM000157    EDW87952.1    KRJ97506.1    GDHF01005924    JAI46390.1    CH954177    EDV59020.1    KQS70597.1    CVRI01000036    CRK92993.1    GAKP01020346    GAKP01020342    JAC38610.1    CH379061    EAL33103.3    CH479189    EDW25471.1    GAKP01020344    JAC38608.1    GECL01003465    JAP02659.1    JXJN01020215    GDHC01003326    JAQ15303.1   
Pfam
PF13193   AMP-binding_C        + More
PF00501   AMP-binding
PF06417   DUF1077
Interpro
IPR020845   AMP-binding_CS        + More
IPR042099   AMP-dep_Synthh-like_sf       
IPR000873   AMP-dep_Synth/Lig       
IPR025110   AMP-bd_C       
IPR009445   TMEM85/Emc4       
IPR030304   FATP4       
Gene 3D
PDB
3R44     E-value=6.89473e-13,     Score=182

Ontologies

Topology

Length:
829
Number of predicted TMHs:
5
Exp number of AAs in TMHs:
109.81164
Exp number, first 60 AAs:
32.5758
Total prob of N-in:
0.63111
POSSIBLE N-term signal
sequence
outside
1  -  24
TMhelix
25  -  45
inside
46  -  51
TMhelix
52  -  74
outside
75  -  321
TMhelix
322  -  344
inside
345  -  693
TMhelix
694  -  716
outside
717  -  719
TMhelix
720  -  740
inside
741  -  829
 
 

Population Genetic Test Statistics

Pi
197.399683
Theta
17.879875
Tajima's D
0.23602
CLR
13.563295
CSRT
0.43632818359082
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号