SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01853
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Cytoplasmic   Reliability : 2.871
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCTTGGCTGAATCTGATCCACCATCGCTCCCGTTGAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACACCTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCATCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGATGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTTCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGACTAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCAACGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCTGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPLSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNTSIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFISSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWTRKVKYLGVTLDATMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    GGMS01002955    MBY72158.1    GGMS01006359    MBY75562.1    GFXV01007093    MBW18898.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    RPOV01000134    RPJ78669.1    ABLF02008463    GFTR01008038    JAW08388.1    GGMS01000737    MBY69940.1    S59870    AAB26437.2    GGMR01003407    MBY16026.1    GGMS01017914    MBY87117.1    ABLF02033757    GEZM01053022    JAV74219.1    NEVH01006736    PNF36716.1    ABLF02008153    ABLF02008462    ABLF02008464    GBBI01001646    JAC17066.1    GGMR01000676    MBY13295.1    GGMS01008766    MBY77969.1    GBBI01004571    JAC14141.1    GBYB01008290    JAG78057.1    NEVH01000269    PNF43694.1    ABLF02034467    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01006721    PNF37225.1    GEZM01038405    JAV81653.1    NEVH01017542    PNF24034.1    NEVH01022639    PNF18527.1    GFTR01008262    JAW08164.1    NEVH01026386    PNF14434.1    GFDF01007661    JAV06423.1    GGMS01002992    MBY72195.1    ABLF02024246    GEZM01084969    JAV60363.1    NEVH01020940    PNF20481.1    GGFJ01001857    MBW50998.1    GGFJ01001858    MBW50999.1    GBGD01000880    JAC88009.1    GFTR01008246    JAW08180.1    GBGD01000799    JAC88090.1    GGMS01017365    MBY86568.1    GFTR01008271    JAW08155.1    ABLF02037660    GFTR01008256    JAW08170.1    NWSH01000032    PCG80496.1    NEVH01002704    PNF41489.1    PCG80497.1    ABLF02020655    ABLF02039168    ABLF02061060    NEVH01020071    PNF21969.1    NEVH01010546    PNF32261.1    NEVH01023962    PNF17612.1    NEVH01003017    PNF40781.1    ABLF02028535    ABLF02028545    GFTR01008251    JAW08175.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01011193    PNF32021.1    GEZM01074951    JAV64378.1    GBBI01001570    JAC17142.1    ABLF02041767    NEVH01005938    PNF38077.1    GGMR01000857    MBY13476.1    AY060438    AAL25477.1    NEVH01001355    PNF42855.1    GGMR01003864    MBY16483.1    GFTR01008151    JAW08275.1    GFTR01008279    JAW08147.1    GGMR01014053    MBY26672.1    NEVH01016302    PNF25823.1    NEVH01007838    PNF34986.1    NEVH01014858    PNF27387.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
736
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.99972000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04100
outside
1  -  736
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
113.026996
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号