SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01823
Pre Gene Modal
BGIBMGA005984
Annotation
PREDICTED:_uncharacterized_protein_LOC105842764?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.35
 

Sequence

CDS
ATGGTGAACACTCGAAGTGATAACCGTGCTAGCCGAAATCGCAGGGATGAAGATGCAACGGACCCGTCGTCTGTCCGCGTCCCGCGATCGGTCTCCCCGAGCGCGTCCGCCGCCCAAGAAAATGGCGCCGGCGACGCCTCGCGCACAATCTACGAGCCTTTTCGAGAAGCATCTACGAGCGCGTCTCCCGCCTGCGAAATCGGCGCCGGTGACGCCTCGCGCTCCAATCACCACAACGGATCCGGCGACAGCCACGTGGCCCCCGCCGAAGCCACCTTCTCCAGCGAGCACGTGTCAACAATAGTAGAGGCACTACAGCGGAGCCAAACAGAGGTTTTGAAATCATTATTTGAAACGATACGGCACAACACATCAACACCAGTGCCCGCATCACATGCACACGCGAACTTCGCCCGATGTACCGCGCGCTTTAGTGGGACTGCAGGTGAGTCGCTTGATGCCTTCCTGGATGCGGCCGAGGCCTATCGCGATTGCTCCGACATCTCGGATGAGAACGCCGTCCGGGGATTGTCGATGCTGTTGTGCGGCGACGCCGCCGTCTGGTGGCTGGGTGTGAAGTCCTCCATATCTTCGTGGTGCGATGCCGTATCAGCCCTACGAGACGCTTTCGGTGATCGCAGACCTCCACACCGTATATACGCTCAACTATTCAAACGAGGTCAACAAAACGACGAAAGAACGGACCGATTCATCGCTGCGACGCGCGCTCTTCTCGCGAAGCTACCTGCCGGCGACCTGAGCGAGAAAGTCCAGCTGGACATGATCTACGGACTCCTCAGCCGCCGCGTACGGGAGAGACTTCGCCGCGACGAAGTAAGTTCATTCGACGTGCTCCTGCAAAGAGCGCGCCAAATTGAAGACGCGACGGACGAACTTCGCTACGAGCACGATGCCTCAAGACCGACGGGAGAATTAGCAAGAAAACCATACGAGTCGACGACCGGCACCGGACGCACCCGCCCTCCGCCAGCAACCGCAGCGCGCACGGCCGCGTGCGCTCCGAGCGGCGCCGCCCCCGGCCACGAGCCCGCGACGCAGCCGCCGCGTGTATTTGACTCCGTCGAAAGGAAGCGACGCCCGAAATGTTCGTATTGCCATTTCTTCGGTCACGAGAAGAACCAGTGTCGTAAGTTAGATTCAAAACAAGGTGATCAATCTCATACTAACTTATTTAAAAATAAAACTCACTCCAAATCTAGTGAAAGTGAAGTTAAAAGTGATCAGTCATTTTATTGTGTCGATTCAAAAGAGTGTTTTAAATTTGAAAACGACAAATCAGTAAAAGACCGTATTCATAGTTCTAATTTAGTGCATGAAACTTGTATACCTATTTTGCCAAATAGTGATGCATGCACTGATACCTACACACAGTATAAACAGCGGCGAATTCCACAAAATTATAATTTTGCTGCCCATAATTCAAATCGTTCGCGGTTTAAGGTTACTGATAACAGTGATAATGCCGATCGAGCTCGTATTGATCGCCAAGGTTCTTCTCGAGAAAAGAACCACAATATCACTGCATGCAACACGAAATGCATAACATGTAATCGATCGAGCGACGATCGCATAAATAATAATAGTCCGAGCGAAAACATTACTCATGTTAACCCTTCAGCCGCCACAACTGAAAATGTTAACTCTTTGGTTGCCGGACGTAAAAATGATAATTTGGATATGTTTCCTAGTGTCGACGGACATCCTTGCTGCAATGCCAATGCAAACTGGCAATGTCAAACAGTAACCTGCGCGGTCGCAGAGGATTCAAATTTTGTTCATCAAAGATGTCCGGGCGACAGTAATATTTGTACACCATTAGTTGAAAATTATTGTGATAAAAACGGGATAAACCCGAATTTTCCGAAATATGGGAATAAGCGTGATGTAATGGGATTTGATTGTTTTTATGGTTGCGGCGGAGATGATGATCTTACGGGACCCCCTATTGGTCGTGACGTACGGCCGATTTTCAACATAAATATACTGGGTTTTGACGGCACCGCTTTAATAGACACAGCTGCAAAACACTGCATCGCGGGTCATACGCTATATGCTCTCCTCCAGCAGAACAACCATCCTCTCCGCGTTTCCTCTCAACGAGTCAGACTTGCCGACGGTGTGGTGCGCATTATGGACGTTTTTACCACCACACTCGATGTACGCCTAGAGACGACAATTATTTCCACTCCATTCCTCATATTTCCTGAATCCACCAATAATGAAACGTTATTAGGAATAGATTTTATTACCGCAGCTGGAGTAGTAATCGACTTCAAAGAAGAGGTTTGGTTCTTCAGTGATGATGCGATGGTAAAGTATAATCTGTGTTTCGAACCTAAGTCGCGCAAAGTTTCCTGCGCCGCTACAGACATCCTTAGGGATGACGAAGGTACTCACCTTACGCCAGCTGAGCGGCAAGCGCTCGCTGACGTACTGGACAGGCACGCACACATCTTCAGAGCAGGGGGAGGTCCAACACCGTTTGCTGAGCATCGCATCGAAACAGGTGAGCATGCACCAATTTCAGTACCTCCTTACTGTTTGAATCCTTCGAAGAAACCGCCTGATGTTATATTAGGGAAATACCATACTCAAGACCTTACCTGTTACCACGGTAATAAAGACTCCTTACCCAAACCTGTGATTCCTAAGAGGAAACGTGGACGCCCATCTAAGGCTGTTGATGTCCTAGTCCAGGAGCGAGGGCGTTCTCCAGGACTAGAGGGGGAGTATATAGCAACCCTAACGCCTGCCGCATCGGCAGCCGCGTCTGATCGCGCGCCGCGACCAATCAGGGACTCTCGTTGTCGGCTCCCGGCGCGACTCAAAGAGTAG
Protein
MVNTRSDNRASRNRRDEDATDPSSVRVPRSVSPSASAAQENGAGDASRTIYEPFREASTSASPACEIGAGDASRSNHHNGSGDSHVAPAEATFSSEHVSTIVEALQRSQTEVLKSLFETIRHNTSTPVPASHAHANFARCTARFSGTAGESLDAFLDAAEAYRDCSDISDENAVRGLSMLLCGDAAVWWLGVKSSISSWCDAVSALRDAFGDRRPPHRIYAQLFKRGQQNDERTDRFIAATRALLAKLPAGDLSEKVQLDMIYGLLSRRVRERLRRDEVSSFDVLLQRARQIEDATDELRYEHDASRPTGELARKPYESTTGTGRTRPPPATAARTAACAPSGAAPGHEPATQPPRVFDSVERKRRPKCSYCHFFGHEKNQCRKLDSKQGDQSHTNLFKNKTHSKSSESEVKSDQSFYCVDSKECFKFENDKSVKDRIHSSNLVHETCIPILPNSDACTDTYTQYKQRRIPQNYNFAAHNSNRSRFKVTDNSDNADRARIDRQGSSREKNHNITACNTKCITCNRSSDDRINNNSPSENITHVNPSAATTENVNSLVAGRKNDNLDMFPSVDGHPCCNANANWQCQTVTCAVAEDSNFVHQRCPGDSNICTPLVENYCDKNGINPNFPKYGNKRDVMGFDCFYGCGGDDDLTGPPIGRDVRPIFNINILGFDGTALIDTAAKHCIAGHTLYALLQQNNHPLRVSSQRVRLADGVVRIMDVFTTTLDVRLETTIISTPFLIFPESTNNETLLGIDFITAAGVVIDFKEEVWFFSDDAMVKYNLCFEPKSRKVSCAATDILRDDEGTHLTPAERQALADVLDRHAHIFRAGGGPTPFAEHRIETGEHAPISVPPYCLNPSKKPPDVILGKYHTQDLTCYHGNKDSLPKPVIPKRKRGRPSKAVDVLVQERGRSPGLEGEYIATLTPAASAAASDRAPRPIRDSRCRLPARLKE

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
951
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0659799999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00333
outside
1  -  951
 
 

Population Genetic Test Statistics

Pi
396.683162
Theta
209.721537
Tajima's D
2.42057
CLR
0.565044
CSRT
0.937253137343133
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号