SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01816
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Sodium/hydrogen exchanger       + More
Guanylate cyclase      
Location in the cell
Extracellular   Reliability : 3.681
 

Sequence

CDS
ATGTATGAGGACATTTCCAGAGCCATGCATAGCTTTAAAACTCACATCACCATTGTCATGGGGGATTTCAACGCCAGACTGGGTAAACGGTCCGAGGGGGAGCTGCGAGTGGGACCATTTGGATTTGGGAATCGAAATCATCGGGGAAACTTACTTGCCGGTTTCATGGAGAAAGAAGAATTATTTATGATGAACTCTTTCTTCCAAAAACGGAATCACAGGAAGTGGACCTGGATGAGCCCCAATGGTGCCATCAAAAATGAGATAGATTTCATTATGTCGACAAAAAGGCAAATATTCAATGATGTCTCTGTGATCAATATGGTTAAAACAGGAAGTGATCATCGGATGGTAAGAGGCACATTGAACCTCAATATTAAGCTTGAGAGATTCCGACTGATAAGGTCTACGCTCCGTCCAGCACCAGCTCAGATCCAAAGTTCTGGGCACTTTCAGCTCGAACTTCAAAACCGCTTCGATTGCCTAGGAGGCTCCGTGGACGATTACAATGACGGGTTTGTGAATGCTGTCCATACGATTGGTTCCAAGTTTTTTGGAGCCCGTCGTACAAACAGAACCAAAAAACTCTCAGACCCTACTCTCAAACTCATGGAAGAACGTCGCGGAATGATTTTGCAGTCTTCAGAAGATTCGTTTAAATATCGGTCTCTCAACAGACAGATCTCAAAGTCTCTTAAATTTGATCTACGCCGTTTTAATACTGAGCGTATTAAAGAGGCTATAGAACGAAACAAAGGCTCCAAGGTGTTCGCGAGAGATTTGTCTCTTGGGAAAAGCCAGTTGACAAGACTGAAGATCGATGATGGCAGGATCATTTCGTCCAAGCCTGAGCTTTTGAGAGAGGTCGAGAAGTTCTATGGACAGCTATACACATCTACTCGACAACCCGTGGAATATCTAGCAAAGGATCCAAGAGCTAGATTAGTCCGACACTATACCGAAGATATCCCCGACATCAGCCTGTGCGAGATTAGAATGGCTCTCAAGCAACTTAAGGACAACAAGGCACCGGGCGAGGATGGAATTACCGTCGAACTTCTGAAGGCGGGTGGAAAACCAGTCCTTCGGGCCCTACAAAATTTATTTAATTCCGTCATTCTCGATGGGAATGTGGCCCTGGCATGGACCAGAAGTGTGGTGGTACTGTTCTTCAAAAAGGGTGACAATACTCGTTTGAAGAATTATAGACCCATCTCACTTCTGAGTCATGTCTATAAGTTGTTCTCGAGAGTTATTACGAACCGTCTCGCGCGCAGGTTTGATGACTTCCAGCCACCCGAACAAGCCGGTTTCCGAAAAGGCTATAGTACCGTAGACCACATTCATACGTTGCGGCAGATTGTACAAAAGACCGAGGAATATAACCTGCCGCTTTGCTTAGCATTTGTGGACTACGAGAAAGCCTTTGATTCGATTGAAACCTGGGCCGTGTTACAGTCTCTCCAACGGTGCCAAATTGATTATCGGTATATCGAAGTGTTGAGGTGTTTGTATGAAAACGCTACTATGTCAGTCCGAGTACAGGACCGGGCTTCAGAACCTATCCTTCTGCAGCGGGGCGTGAGGCAAGGAGATGTTATTTCTCCGAAACTATTTACCGCTGCGCTGGAAGATGTTTTCAAAGTTCTGGACTGGAAAGGACTAGGCATCAACATAAACGGCGAGTACATAACTCACCTTCGGTTCGCCGATGATATTGTGATTATGGCCGAGACCATGGAGGACCTCAGCACAATGCTCAAAGACCTCAGTAGGGCTTCTATCCGAGTGGGTCTAAATATGAACAAAGAAAAAACAAAAATTATGTTGAATGCTCATGTAGCGCCCACTCCAGTAAAGATCGGAGGCTCTACGCTCGAAGTTGTTGACGAGTATATTTACCTGGGACACACTGTCCAGCTAGGTAAGTCCAACTTCGAAAAAGAGGTCAACCGTCGAATCCAGCTCGGATGGGCAGCGTTCGGAAAGCTACGTAAAATCTTCTCATCACAAATACCACAGTGTCTCAAGACGAAAGTCTTTGACCAGTGTGTGTTGCCAGTGATGACATATGGCACTGAGACGTGGTCGCTCACAATGGGCCTTATGAGAAGGCTCAAGGTCACCCAAAGAGCAATGGAGAGGGCTATGCTCGGAGTTTCCCTGCGAGACCAAATCAGAAATGAGGAGATTCGCAGGAAAACCATGGTAACCGACATAGCCCAAAGGATTGCGACACTGAAGTGGCAGTGGGCAGGACACATTGCTCGCGGAACAGATGGCCGTTGGGGCCAGAAGGTTCTTGAGTGGCGACCGCGTACTGGGAGACGTAGCGTGGGTAGGCCTCCCACAAGGTGGGCCGACGACCTATTAAGGTTCGCGGGGATCCGCTGGATGCAGGCAGCGCAGGACCGGTCTTTGTGGCGAGGCTTGGGGGAGGCCTATGTCCAGCAGTGGACGTCCATGGGCTGA
Protein
MYEDISRAMHSFKTHITIVMGDFNARLGKRSEGELRVGPFGFGNRNHRGNLLAGFMEKEELFMMNSFFQKRNHRKWTWMSPNGAIKNEIDFIMSTKRQIFNDVSVINMVKTGSDHRMVRGTLNLNIKLERFRLIRSTLRPAPAQIQSSGHFQLELQNRFDCLGGSVDDYNDGFVNAVHTIGSKFFGARRTNRTKKLSDPTLKLMEERRGMILQSSEDSFKYRSLNRQISKSLKFDLRRFNTERIKEAIERNKGSKVFARDLSLGKSQLTRLKIDDGRIISSKPELLREVEKFYGQLYTSTRQPVEYLAKDPRARLVRHYTEDIPDISLCEIRMALKQLKDNKAPGEDGITVELLKAGGKPVLRALQNLFNSVILDGNVALAWTRSVVVLFFKKGDNTRLKNYRPISLLSHVYKLFSRVITNRLARRFDDFQPPEQAGFRKGYSTVDHIHTLRQIVQKTEEYNLPLCLAFVDYEKAFDSIETWAVLQSLQRCQIDYRYIEVLRCLYENATMSVRVQDRASEPILLQRGVRQGDVISPKLFTAALEDVFKVLDWKGLGININGEYITHLRFADDIVIMAETMEDLSTMLKDLSRASIRVGLNMNKEKTKIMLNAHVAPTPVKIGGSTLEVVDEYIYLGHTVQLGKSNFEKEVNRRIQLGWAAFGKLRKIFSSQIPQCLKTKVFDQCVLPVMTYGTETWSLTMGLMRRLKVTQRAMERAMLGVSLRDQIRNEEIRRKTMVTDIAQRIATLKWQWAGHIARGTDGRWGQKVLEWRPRTGRRSVGRPPTRWADDLLRFAGIRWMQAAQDRSLWRGLGEAYVQQWTSMG

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Sodium/hydrogen exchanger
EC Number
4.6.1.2
EMBL
FJ265549    ADI61817.1    FJ265543    ADI61811.1    FJ265544    ADI61812.1    + More
FJ265542    ADI61810.1    FJ265545    ADI61813.1    FJ265550    ADI61818.1    FJ265551    ADI61819.1    MRZV01002136    PIK34564.1    KZ149907    PZC78256.1    ODYU01004088    SOQ43598.1    GBBI01004876    JAC13836.1    FJ265561    ADI61829.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    FJ265564    ADI61832.1    FJ265562    ADI61830.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001354    EYC21986.1    JARK01001655    EYB84321.1    JARK01001711    EYB81734.1    AAGJ04050748    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001730    EYB81048.1    GBGD01000453    JAC88436.1    GBBI01004877    JAC13835.1    FJ265563    ADI61831.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    GDKW01001596    JAI54999.1    JARK01001543    EYB91356.1    JARK01001389    EYC11015.1    GBGD01000380    JAC88509.1    JARK01001639    EYB85201.1    DS268591    EFO92565.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    DS268444    EFP01729.1    JARK01000347    EYC38051.1    JARK01001626    EYB85833.1    JARK01001340    EYC30828.1    JARK01001438    EYC02111.1    JARK01001568    EYB89432.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    ODYU01008249    SOQ51673.1    JARK01001683    EYB82909.1    EYC16376.1    JARK01001395    EYC09730.1    EYC09729.1    JARK01001505    EYB94618.1    JARK01001353    EYC22263.1    EYB94617.1    JARK01001459    EYB99276.1    JARK01000343    EYC38099.1    EYB99275.1    JARK01001473    EYB97806.1    EYB91353.1    JARK01001348    EYC25048.1    EYC25050.1    JARK01001531    EYB92324.1    JARK01001424    EYC04316.1    EYC04315.1    EYC04317.1    EYC04314.1    JARK01001475    EYB97550.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    EYC25046.1    JARK01000077    EYC43894.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
PF00069   Pkinase
PF00201   UDPGT
PF00211   Guanylate_cyc
PF07714   Pkinase_Tyr
PF01094   ANF_receptor
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR001507   ZP_dom       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR017441   Protein_kinase_ATP_BS       
IPR000719   Prot_kinase_dom       
IPR002213   UDP_glucos_trans       
IPR029052   Metallo-depent_PP-like       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR001170   ANPR/GUC       
IPR028082   Peripla_BP_I       
IPR001054   A/G_cyclase       
IPR029787   Nucleotide_cyclase       
SUPFAM
SSF56219   SSF56219        + More
SSF56436   SSF56436       
SSF56112   SSF56112       
SSF53822   SSF53822       
SSF55073   SSF55073       
PDB
6AR3     E-value=2.71331e-06,     Score=125

Ontologies

Topology

Length:
823
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04381
Exp number, first 60 AAs:
0.000690000000000001
Total prob of N-in:
0.00068
outside
1  -  823
 
 

Population Genetic Test Statistics

Pi
138.243749
Theta
150.55299
Tajima's D
0.113044
CLR
0.024962
CSRT
0.3970801459927
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号