SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01786
Pre Gene Modal
BGIBMGA006152
Annotation
PREDICTED:_tubulin_glycylase_3A-like_isoform_X2_[Bombyx_mori]
Full name
Tubulin glycylase 3A      
Location in the cell
Cytoplasmic   Reliability : 2.222 Nuclear   Reliability : 1.571
 

Sequence

CDS
ATGGAATTAGAGGAAAGTGTATCAGACTCCAAGCTCCACAAAGAGAGTACGGCTAAAAAAGATTTAAGGCCTTCTAGCGCTATCTCGTTTTCTAAATCTGATCATGGCCCAGAAACAACTTCATCAACGGAACAACTTCGTCAGTATAAAAGTTGGGTCAGCAACGAAAGGTGGAATGAATTGAAAAAGATCGCGGAAACAGCGATGAAACAACGTAAGGTTTTCATGATTAAAGGCGGCGGTTTCCCAGCAATCCGTCGGGCCATGCTTGAACGAGGCTGGGTAGAAAAATATGAATCCCATAAGGTACGTCATCCTCCAACAAACGTAGATCCTAAAAAAGCGTCTGGCAAAGAGCTCTCCAAAGTAGAAAGAATGATACTCTACAAGTTCATGGAACATCACTCTGTTGATTTTCTATGGACGACCAAACGTGATAAATATGATTGGTTACTTAGTAACAAAGATGTCATGATAAGCAGATTTTGTAGATCCGTGTTCACGACGAAAGAGGGTTTAACTGCTTCGTTGACGCAAATGCATTGGCACACTGAGCCTGGGATTGCACTTACGAAGTTTCCACGATGCTACAATATACACAACTCTGATAGCCTCGAAGAATTCGTCGATGACTTTAGGATCACGGCCTGTATCAGCGTTCTTAAATGGCTTTGTAGTACTTTACAAATCAATGGAGAACAAAATCTAATTTCGAATCAGGGGAAAGTTCCTTTCAGCGCCATTGAATTTGCCACCAGTAGACTAAACGAATATGTTTTGTTCTTTACACATAAAGACATCGATGATACAGAGGAACAGGTCCATGTTTGGGAACACGAATGGGATCAATTCTTAACTCACCATTACCTTCTCGTGCACGAAAAAGCAAAGTTTAGCAATGATAACAATACAAGTATAAGGCAACTCGAAAGAAAAGCGTCTAAGGTTTTAACTACGATGAGCAAGTTCTGGCCTCAAATCGATATTGATGGTGTGCTCAATATTTGGATCGTAAAGCCTGGTAACAAATGCCGAGGTAGAGGTATTCAGCTCATGAATAATATAAAGGATATAATTGGCTTAATTAATATTCCTGTACAGAAAACAAGATATGTTGTGCAAAAGTACATTGAAAATCCATTAGTGATTTACGACACAAAATTCGACATAAGGCAGTGGTTTCTGATCACTAACTGTCAACCGTTAACAATATGGGTTTACAAGGACAGCTACCTACGATTTAGTTCACAGATATTCAGCCTCTCTAACTATCACGAATCGGTTCACCTAACCAACAATGCTGTTCAAACTAAATACAAGAATAATGAGGACAGAGACAAAGCTTTACCCGACGAGAACATGTGGGACTGTCACACGTTTAAGGCCTATCTAAAACAGATCGGTAAATATGAACTGTGGGACACTAAAATATATCCTGGAATGAAACAATGTTTGGTTGGAGCAATGTTGGCCTGCCAAGAAACAATGGATAAGAGACAGAACAGCTTTGAGCTTTACGGAGCTGATTTTATGCTTACTGAAGACTTTACACCTTGGCTCATTGAAATTAACTCCAGTCCAGATTTAGCACCTACTACTTCAGTTACGGCTAGGTTATGTCCTCAGTGTCTAGAAGATGTAATCAAAGTTGTTTTAGATCGCCGCTTAAATCCAGATGCTGACACAGGAACTTTTGAGTTAGCCTACAGGCAAACTATACCGAAAGCACCGGCATATCTTGGGTTGTCACTTTGTATCAACGGTAAAAGACTTTTTAAGAAGTCGAGAGAGAAAAAGCATGATACGAGAAGTATTACACCGGTAGCACCACGAGAACCAGCTGGCGATACCATTCCCGATGCAGACCTACCCGTTCCCCCCGAATATTCGGGACCTATTATCACGGATTTCCTCAGCTGGTTAAACCCTTATGATGCTCTGCCTTGTAATAAGGATGGTATTTTATTAGGTCCCAAAGATTCATTGACGGACACACCGAGGAAGAAAAGAAAAAACGGAATTTAA
Protein
MELEESVSDSKLHKESTAKKDLRPSSAISFSKSDHGPETTSSTEQLRQYKSWVSNERWNELKKIAETAMKQRKVFMIKGGGFPAIRRAMLERGWVEKYESHKVRHPPTNVDPKKASGKELSKVERMILYKFMEHHSVDFLWTTKRDKYDWLLSNKDVMISRFCRSVFTTKEGLTASLTQMHWHTEPGIALTKFPRCYNIHNSDSLEEFVDDFRITACISVLKWLCSTLQINGEQNLISNQGKVPFSAIEFATSRLNEYVLFFTHKDIDDTEEQVHVWEHEWDQFLTHHYLLVHEKAKFSNDNNTSIRQLERKASKVLTTMSKFWPQIDIDGVLNIWIVKPGNKCRGRGIQLMNNIKDIIGLINIPVQKTRYVVQKYIENPLVIYDTKFDIRQWFLITNCQPLTIWVYKDSYLRFSSQIFSLSNYHESVHLTNNAVQTKYKNNEDRDKALPDENMWDCHTFKAYLKQIGKYELWDTKIYPGMKQCLVGAMLACQETMDKRQNSFELYGADFMLTEDFTPWLIEINSSPDLAPTTSVTARLCPQCLEDVIKVVLDRRLNPDADTGTFELAYRQTIPKAPAYLGLSLCINGKRLFKKSREKKHDTRSITPVAPREPAGDTIPDADLPVPPEYSGPIITDFLSWLNPYDALPCNKDGILLGPKDSLTDTPRKKRKNGI

Summary

Description
Polylycylase which modifies alpha- and beta-tubulin, generating side chains of glycine on the gamma-carboxyl groups of specific glutamate residues within the C-terminal tail of alpha- and beta-tubulin. Involved both in the side-chain initiation and elongation steps of the polyglycylation reaction by adding a single glycine chain to generate monoglycine side chains and by elongating monoglycine side chains to polyglycine side chains.
Keywords
ATP-binding   Complete proteome   Cytoplasm   Cytoskeleton   Ligase   Microtubule   Nucleotide-binding   Reference proteome  
Feature
chain  Tubulin glycylase 3A
EC Number
6.3.2.-
EMBL
BABH01004775    NWSH01000013    PCG80846.1    AGBW02009882    OWR49656.1    KQ460855    + More
KPJ11884.1    DS231970    EDS29740.1    CH477196    EAT48373.1    JXUM01003334    JXUM01003335    JXUM01003336    JXUM01003337    JXUM01003338    JXUM01003339    JXUM01003340    JXUM01003341    KQ560156    KXJ84138.1    AJVK01006597    ADMH02000503    ETN66181.1    ATLV01014106    KE524943    KFB38333.1    AXCM01001818    AJWK01010432    AXCN02001993    APCN01001680    AAAB01008980    EAA13905.3    AE014134    CM002910    KMY88609.1    CM000157    EDW87845.1    CH954177    EDV59123.1    CH940649    EDW63600.1    CH480818    EDW51902.1    CH916368    EDW02892.1    CH379058    EAL34477.2    CH479184    EDW36941.1    KQ971343    KYB27443.1    CH933807    EDW11723.1    CH963920    EDW78060.1    OUUW01000010    SPP85706.1    CH902620    EDV31571.1    CP012523    ALC38434.1    GEZM01058136    JAV71877.1    GEZM01058134    JAV71879.1    JXJN01017195    CCAG010016184    CVRI01000047    CRK98567.1    GBRD01006539    JAG59282.1    JRES01000973    KNC26660.1    GBRD01006538    JAG59283.1    AAZX01007838    GL446618    EFN87487.1    GEBQ01025960    JAT14017.1    KB632364    ERL93609.1    NNAY01000494    OXU28004.1    GL763505    EFZ19550.1    GECZ01001763    JAS68006.1    QOIP01000010    RLU18082.1    ADTU01008677    KZ288283    PBC29514.1    KK107167    EZA56223.1    GBYB01007581    JAG77348.1    GEDC01008582    JAS28716.1    GL435087    EFN74052.1    KQ981382    KYN42289.1    KQ977279    KYN04107.1    KQ435700    KOX80565.1    ACPB03006613    GBYB01007582    JAG77349.1    KQ978615    KYN29843.1    KQ982959    KYQ48737.1    KQ434822    KZC07100.1    KQ976435    KYM87039.1    GL888177    EGI65851.1    DS235742    EEB16186.1    APGK01037623    APGK01037624    KB740948    ENN77387.1    HACA01007285    CDW24646.1    LJIJ01000012    ODN05957.1    DS469545    EDO44351.1    KYB27442.1    PCG80845.1    GECZ01019878    JAS49891.1    GECZ01030690    JAS39079.1    KPJ11885.1   
Pfam
PF03133   TTL
Interpro
IPR004344   TTL/TTLL_fam        + More
IPR013815   ATP_grasp_subdomain_1       
Gene 3D
PDB
5VLQ     E-value=6.65287e-101,     Score=940

Ontologies

Topology

Subcellular location
  
Length:
674
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01566
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00021
outside
1  -  674
 
 

Population Genetic Test Statistics

Pi
205.87713
Theta
189.62094
Tajima's D
0.392398
CLR
0
CSRT
0.487625618719064
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号