SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01782
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.482
 

Sequence

CDS
ATGAGGGCAAGAATATCGCAATACAAGTACACCAAGACTGTTAGGACAAGAAAGTTTGATACCTCAAAGTTAAAGCGACGGCCAGGGGTGAACTCTGAGTACATTGAGTGTGTGGGCCAAGAACTGGATAAGATAACAGATAATAGAAATAGTAATGTAGATTCTGATGAAATATGGCAACGCCTGAAATCTGCAGTTACAACAGCAGCTACGAAAGTTCTTGGACACGAAGAAAAGCGAAAACGGAATGGGTGGTTCGACGATGAATGCCAAAAAGTCACAGATGCGAAGAATAAGGCTCATAAATTATTGCAGCAAAAACTCACTCGGTGCCGTAGAGAGGATTACAGAAACCTTAGGATTAAAGAAAAACAGCTACACAAAAGGAAGAAACGAATGTTTGAAGAGCAACAACTTAAGGAAATTGCAAATAGTTACTCAAAGCAGGAATCCAGGATTTTCTACAAGCAAGTGAATAGCGGAAAGAAGGAATTTAAACCAAGAACCTCAGCCTGTAGAAATAAAGATGGCCAACTGCTTAATGACAGAACAGAAGTCATTAAAAGGTGGGCAGAACACTTCCAAGAGCTACTAAACAAACCATCAGTTGCTACTCATATCGATGAAGTCGAAGCTCCACTTAATCATCAGTGGCTAGAAGTGTCCCAACCGTCTCTGGAAGACACCAGAGCTGCCAGCCAAAAACTCAAAAACAATAAAGCTCCAGGAAACGACAACATCCAGAGTGAACTACTGAAATACGCTGGGTCCCAGTTTGAAGAGGAATTCCATAAACTAGTACTGCAGATATGGAATTCTGAAGTTATGCCTGAGGAATGGAACACAGCGGTTATTTGTCCTCTCCACAAGAAGGGCGATGTTCTCGACTGTCAGAACTATCGAGGCATTTCACTCCTCAATACAGCATATAAGATATTTGCGAACGTTCTCTTTGGCAAATTAAAACCTTTCGTGGAGCCTAGACTAGGAGAATATCAGTGTGGTTTCCGACCTGGCAGATCAACCATCGACCAAATCTTCTCCCTACGACAAATACTTGAAAAAACTCTTGAATTTAATGCTGACACGTATCACCTTTTTATTGATTTTAAAGCTGCCTACGACAACATAAGCCGTGATTTCCTATACCAGGCTATGCATGAGATTGGCGTACCACCGAAGCTTATATCTTTAACAAGGATGACACTGGTTGCATCGCAAAGCATTGTTAAGATCCAAACAGACCTATCGGATCCTTTTAGAACCCATGATGGACTAAGGCAGGGTGATGCCCTCTCCTGCCTTCTTTTCAATGTTGCACTCGATAAGTGTATCCGTGACTCAGCAATAGAGACGACGGGCAATATATATTACAAATCCGCTCAAGTACTGGGATATGCGGATGATATTGACGTCATTGGCAGATCAGCTCTCGCAGTAGAAAGTGCGTACCTTGCTCTCGAGGCCTCGTCTCTCGAAGCCGGTCTCCAAGTAAACGCAGACAAAACTAAATTCCTGAGGGTGTCGAGGGACTTACGTGAGGACACAGCGCATAAAAATATTGGCCAGCATACTTTTGGATCTGTGAATGAATTTGTATATCTTGGTTCTCTGATAACGAATAATAATAATATAACAGCAGAAATAGTTAAGAGAATACTGTCGGCGAATAAATGCTACTTCGGCCTGCTTAAATATTTCTGTTCCAAAATTCTGTCACGAAATATCAAAATTCTTTTATACAAGACCCTACTGAGACCCATTCTTATTTATGGCTCAGAGACATGGGTACTCAGCAAAAAAGATGAGAACCGTCTACTTGTGTTCGAGCGTAAGATTCTAAGACGGATATTCGGTGCTGTGCGGGAAAACGAGATATGGAGGACGCGCTATAACCACGAGTTGTATGATGTTTACAAAGATCCTAACATCATAACAACTATAAAGATTGGACGCCTACGATGGGCAGGACATGTGGTTCGAATGGAGAGTACCAGAATGCCAAGACAATTGCTCTATGGCAAACCAGAGGGCCGCAGAAGTCGTGGCAGACCCAAACTTCGATGGTTGGATGGCGTGGAGCGCGACCTCAAAAATATCGGCGTCAAGAACTGGAAGGAGAAAGCCCAGAACCGAGCAGTCTGGAGAGACATACTGGACCAGGCTAAGGCCCACCCTGGGCTGTAA
Protein
MRARISQYKYTKTVRTRKFDTSKLKRRPGVNSEYIECVGQELDKITDNRNSNVDSDEIWQRLKSAVTTAATKVLGHEEKRKRNGWFDDECQKVTDAKNKAHKLLQQKLTRCRREDYRNLRIKEKQLHKRKKRMFEEQQLKEIANSYSKQESRIFYKQVNSGKKEFKPRTSACRNKDGQLLNDRTEVIKRWAEHFQELLNKPSVATHIDEVEAPLNHQWLEVSQPSLEDTRAASQKLKNNKAPGNDNIQSELLKYAGSQFEEEFHKLVLQIWNSEVMPEEWNTAVICPLHKKGDVLDCQNYRGISLLNTAYKIFANVLFGKLKPFVEPRLGEYQCGFRPGRSTIDQIFSLRQILEKTLEFNADTYHLFIDFKAAYDNISRDFLYQAMHEIGVPPKLISLTRMTLVASQSIVKIQTDLSDPFRTHDGLRQGDALSCLLFNVALDKCIRDSAIETTGNIYYKSAQVLGYADDIDVIGRSALAVESAYLALEASSLEAGLQVNADKTKFLRVSRDLREDTAHKNIGQHTFGSVNEFVYLGSLITNNNNITAEIVKRILSANKCYFGLLKYFCSKILSRNIKILLYKTLLRPILIYGSETWVLSKKDENRLLVFERKILRRIFGAVRENEIWRTRYNHELYDVYKDPNIITTIKIGRLRWAGHVVRMESTRMPRQLLYGKPEGRRSRGRPKLRWLDGVERDLKNIGVKNWKEKAQNRAVWRDILDQAKAHPGL

Summary

EMBL
FJ265555    ADI61823.1    PYGN01000613    PSN43351.1    PYGN01000119    PSN53667.1    + More
GBBI01004263    JAC14449.1    GBBI01004262    JAC14450.1    GBBI01004261    JAC14451.1    PYGN01000254    PSN50032.1    GBRD01011073    JAG54751.1    GGFL01003846    MBW68024.1    GGFL01003845    MBW68023.1    IAAA01017079    LAA06070.1    GGFK01002192    MBW35513.1    GGFK01005184    MBW38505.1    GGFK01002196    MBW35517.1    GGFK01003613    MBW36934.1    GGFK01001798    MBW35119.1    GGFK01001949    MBW35270.1    GDAI01000742    JAI16861.1    CH902657    KPU75308.1    GAPW01000107    JAC13491.1    CH902626    KPU79149.1    KU311054    ALX81665.1    CH902621    KPU81727.1    GDHC01021627    JAP97001.1    CH902619    KPU76535.1    GECL01001585    JAP04539.1    CH902653    KPU74858.1    GALA01001775    JAA93077.1    CH904714    KPU81814.1    GBRD01000202    JAG65619.1    GBBI01004198    JAC14514.1    LBMM01005351    KMQ91586.1    GAPW01000199    JAC13399.1    AJVK01001578    QOUI01000020    RCK67885.1    QOIP01000009    RLU18885.1    PYGN01000372    PSN47498.1    CH902628    KPU75346.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    CH902714    KPU81861.1    CH902666    KPU74610.1    CH902618    KPU79125.1    CH902622    KPU75266.1    KPU77326.1    CH902630    KPU77522.1    CH902633    KPU74667.1    CH902623    KPU72899.1    CH902627    KPU74872.1    GBGD01000331    JAC88558.1    GBBI01004199    JAC14513.1    GAPW01000120    JAC13478.1    PYGN01000287    PSN49259.1    CH963259    KRF97428.1    GGFK01003183    MBW36504.1    PYGN01000629    PSN43121.1    UZAG01001147    VDO10529.1    PYGN01003402    PSN29545.1    GECL01002632    JAP03492.1    PYGN01000451    PSN46127.1    PYGN01000020    PSN57453.1    PYGN01000203    PSN51319.1    PYGN01000047    PSN56294.1    HE799691    CCH14900.1    PYGN01000324    PSN48495.1    PYGN01000219    PSN50892.1    GEHC01000890    JAV46755.1    PYGN01000070    PSN55417.1    GGMR01014652    MBY27271.1    PYGN01001004    PSN38555.1    PYGN01001382    PSN35227.1    GGMR01006433    MBY19052.1    GGMR01010991    MBY23610.1    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    GBHO01037470    JAG06134.1    PYGN01000502    PSN45243.1    ABLF02019047    ABLF02019049    PYGN01000064    PSN55609.1    ABLF02039015    PYGN01000212    PSN51056.1    ABLF02066124    AJWK01020943    GGMR01020071    MBY32690.1    GAPW01000151    JAC13447.1    PYGN01001494    PSN34463.1    PYGN01000510    PSN45119.1    ABLF02018097    ABLF02043469    ABLF02056908    PYGN01000107    PSN54137.1    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    ABLF02027703    ABLF02061609    ABLF02020712    ABLF02020717    ABLF02054820    KPU79150.1    GEZM01048836    JAV76363.1    ABLF02018925   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF05699   Dimer_Tnp_hAT
PF13359   DDE_Tnp_4
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR027806   HARBI1_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=0.00035094,     Score=107

Ontologies

Topology

Length:
728
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0340599999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00269
outside
1  -  728
 
 

Population Genetic Test Statistics

Pi
200.113492
Theta
168.456037
Tajima's D
1.398311
CLR
14.557061
CSRT
0.76271186440678
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号