SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01761
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.512 Nuclear   Reliability : 1.928
 

Sequence

CDS
ATGCTACATAGCAACCTCGACGCCGTACACCACCATCTTGAGACGGCGCAGCCTGCCCTTCTTTTTCTGACGGAGACGCAGATATCTGCTCCGGATGATACTTCGTACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGTGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTACGAAGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCTGTACCCGAGTCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGATAGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCATCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCCTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATTGAGGGGCACGAGCCTTCTCTGTTGGACCTTCTGCTGACCACCGATCCAGCCGGATACAGTGTGGTGGTCGACGCTCCACTTGGATCGTCTGATCACTGCCTTATCCGTGCTGCCACACCACTCTCTCGTCCTAGTCGTCGAACGACGACCAGGTATCGAAGAGTTTGGCAGTATTTGTCAGCAGATTGGGATGGATTGCGTGAGTTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTTGCATGGGATGATGCTAGGAGACGTCGGGATCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAGGGCGAAATCGGAGCACGTTGCTAGAATTGGCGAGCGACTGAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGTAACTTTTGCAGGTCTAGTCTCCCACCACTACGCAAGTCCGATGACAGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCTCCGGTGTGATAGTTCCCTGCCGGAGATCTGCTTTACACAGTGTGCAGTCAGGCGGGAACTCCGACTCCTGGACGTCCATAAGTCGAGAGGGCCAGACGGCATCCCTGCAGTGGTTCTGAAAACGTGCGCCCCTGAGCTGACGCCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCGCTAACAGGGTTCCGTCTTCATGGAAGACTGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATATACAACTCCTGAAGTATCTGGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATTGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCAATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGACGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGTTAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGGGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRSLEQRDLSLLWLRVDHGGCTRVYACLYRSHSSDAGSALIEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGLSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAATPLSRPSRRTTTRYRRVWQYLSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDDARRRRDPNISEERRKYNAASRSYKKVIARAKSEHVARIGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDSLAHSAKEKADLLVKLFASNSTVDDGGATPPNILRCDSSLPEICFTQCAVRRELRLLDVHKSRGPDGIPAVVLKTCAPELTPALTRLYRLSYCANRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGELNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISRDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1163
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00232
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1163
 
 

Population Genetic Test Statistics

Pi
1.065563
Theta
0.694989
Tajima's D
0.860665
CLR
490.994163
CSRT
0.700114994250287
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号