SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01734
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.244
 

Sequence

CDS
ATGAGTGAAGATTGTGTCAGTGAAAGTGCTAGTGACATTGTCGGGTTCCTCCGGGATAGGTACCCGTCAATTAGGGCCGAGTACTTAGCGTATAGGGCCTCCCGTGGCAATCCCTCCCCCCCCGCGTCCGTCGCCGCGTATTTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCCGCGTTAAGTTCGAGCGCACGTTCCAACGATGCGACTCACGAAGCGCCTAACGCTACCCCCACCCCCGCGCCCGCGTCGTTTACGTCATCGCGCGCTTCGTCCGTCGCGACCTCGATCGTTTCGAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGCAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAACAGACTAAATCCGCGACCGCCTCTCGACCGAAAGTAGTAGTTACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGCAGCTGCCCCGCCCCCGCTGATTCTCCAGGAAAAAACTGCGTGGAACCGCGTTTCCCAGGCCCTTCAGGCAAATAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTGATACGCGGAGTCCCTAAAGAACTCGACATCGACTACATAAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCAATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGTTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGCAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTATAGATATCTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCACACATATCGAGGCGTCAGTGTGCCGCATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCTGTCATCATGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCACAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCCCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTGCGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCCTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGCAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGAAGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACCGACGAAGTTAGAGACGCGATCCACAACCTACAACCTAGGAAGGCACCCGGCTCCGACGGCATCCACAACCGCGCGCTTAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGTCCGCACCCACTTAAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCACTAACGGTGCTTTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MSEDCVSESASDIVGFLRDRYPSIRAEYLAYRASRGNPSPPASVAAYFNRASEARRAPPAAALSSSARSNDATHEAPNATPTPAPASFTSSRASSVATSIVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRTRAVESRSSTTKQTKSATASRPKVVVTPESDSARRVTPPPRPKPAPAPKAAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELDIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPVAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIPFYNANGLARQRDQIFEFLRDNLIDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLTHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVIMAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPTTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPCGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDEDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAVRTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000220695,     Score=111

Ontologies

Topology

Length:
1461
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.480140000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1461
 
 

Population Genetic Test Statistics

Pi
0.015006
Theta
0.06112
Tajima's D
0
CLR
294.508141
CSRT
0.110744462776861
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号