SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01725
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.228
 

Sequence

CDS
ATGAAGACTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAATCTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGACGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGAAATTGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGTGGTACGCGGGAAAAAAATATCGGGAAATTCTTTTTTCGGATGAAAAAATTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCGACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTTAGGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTTAATGCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATTCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGCCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MKTSVDDRSRSGRPRSVRTPAVIKAVKARIQRNPKRKQNLLALQMGLSRTTVKRVLNDDLGLRAYRRKTGNCLNARLMDLRLKRCRALLKWYAGKKYREILFSDEKIFTVEESYNKQNDKVYAHSSEEASDRIPRVQRGHFPSSLRVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDFNALDYKIWQHLEEKACSKPHSNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKPCIQNHGGHFE

Summary

EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    AB473770    BAH20555.1    U47917    AAB47739.1    JF779677    AEO90418.1    LNIX01000030    OXA41211.1    JARK01001411    EYC06502.1    UYSL01019905    VDL71189.1    JARK01000255    EYC39473.1    DS268612    EFO94085.1    CAVP010059404    CDL95787.1    JARK01001658    EYB84158.1    JARK01001337    EYC34439.1    PDUG01000005    PIC23776.1    DS268747    EFP00909.1    JOJR01000583    RCN36166.1    JOJR01000015    RCN51257.1    PIC28734.1    PIC29926.1    PDUG01000001    PIC51673.1    DS268508    EFO83264.1    DS268421    EFO88618.1    DS268492    EFP11689.1    PDUG01000006    PIC20538.1    DS268673    EFO98001.1    DS268679    EFO98285.1    DS268466    EFP06959.1    DS268525    EFO85497.1    PDUG01000004    PIC32571.1    PDUG01000012    PIC13506.1    UZAH01029309    VDP05368.1    JARK01001601    EYB87313.1    DS268428    EFO94379.1    UZAH01027257    VDO90094.1    JARK01000059    EYC44525.1    UYSL01020440    VDL74616.1    JARK01001345    EYC27589.1    KX931010    APL98300.1    PIC32570.1    JARK01000176    EYC41234.1    DS268565    EFO90304.1    DS268545    EFO88382.1    UYSL01019770    VDL69590.1    DS268539    EFO88027.1    HE601047    HE600964    CAS00660.1    CAS01013.1    HE601437    CAR99651.1    HE601507    CAR99239.1    HE600938    CAR99786.1    DS268606    EFO93488.1    PIC53815.1    HE601483    CAS00398.1    HE600955    CAS00439.1   
Pfam
PF13358   DDE_3        + More
PF00292   PAX
PF00250   Forkhead
Interpro
IPR009057   Homeobox-like_sf        + More
IPR038717   Tc1-like_DDE_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
IPR036906   ATPase_V1_fsu_sf       
IPR000792   Tscrpt_reg_LuxR_C       
SUPFAM
SSF46689   SSF46689        + More
SSF46785   SSF46785       
Gene 3D
PDB
5HOO     E-value=1.72896e-09,     Score=148

Ontologies

Topology

Subcellular location
Nucleus  
Length:
299
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01183
Exp number, first 60 AAs:
0.00143
Total prob of N-in:
0.14394
outside
1  -  299
 
 

Population Genetic Test Statistics

Pi
127.442445
Theta
66.62711
Tajima's D
1.75313
CLR
6.828167
CSRT
0.838758062096895
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号