SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01724
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.901
 

Sequence

CDS
ATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGTTGCGGGACATCGTTACGCGGGTCATCCGTGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCACGTCTCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVTRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARLSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    + More
KZ149950    PZC76665.1    KZ150386    PZC71062.1    KZ149896    PZC78733.1    KZ150308    PZC71477.1    AB078935    BAC06462.1    LBMM01006538    KMQ90523.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    QOIP01000009    RLU18544.1    LBMM01012027    KMQ86470.1    LBMM01003679    KMQ93242.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    ODYU01009945    SOQ54696.1    KQ460685    KPJ12887.1    LBMM01005733    KMQ91252.1    GL450953    EFN80213.1    QOIP01000010    RLU18098.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    QOIP01000031    RLU14697.1    LBMM01024024    KMQ82631.1    LBMM01006657    KMQ90417.1    LBMM01006110    KMQ90925.1    QOIP01000007    RLU20280.1    LBMM01008682    KMQ88705.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    LBMM01004272    KMQ92618.1    LBMM01005634    KMQ91349.1    LBMM01006662    KMQ90413.1    ABLF02006132    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    LBMM01014909    KMQ85000.1    LBMM01002052    KMQ95336.1    LBMM01015018    KMQ84954.1    LBMM01011877    KMQ86578.1    GGMR01011974    MBY24593.1    LBMM01004505    KMQ92346.1    LBMM01006725    KMQ90373.1    LBMM01007036    KMQ90099.1    LBMM01008349    KMQ88951.1    LBMM01015025    KMQ84953.1    LBMM01006640    KMQ90440.1    LBMM01020326    KMQ83308.1    LBMM01005216    KMQ91703.1    LBMM01014294    KMQ85237.1    GEHC01001045    JAV46600.1    LBMM01020849    KMQ83202.1    LBMM01003245    KMQ93755.1    GAPW01002043    JAC11555.1    ABLF02017307    CH963857    KRF98317.1    GGMR01006442    MBY19061.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
268
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01898
Exp number, first 60 AAs:
0.00892
Total prob of N-in:
0.00640
outside
1  -  268
 
 

Population Genetic Test Statistics

Pi
66.943993
Theta
54.852785
Tajima's D
1.042476
CLR
0
CSRT
0.669666516674166
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号