SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01704
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Extracellular   Reliability : 2.43
 

Sequence

CDS
ATGTACGAGCCCGATCAAGTCATCATCATTATCCTGCCCTTCTCCCAGTCACCTGGGGTCGGTGCAACATGTTTTCTCCTTCCATACTCTTCTATCAAATACCATTTCTTCGCTCACTCCCCTCCTACCCATATCGCCTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTCCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACAATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAACAAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACTTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGTGTTCGCTGCGAAAAGGCACAGCCACGAAGAAACGTGCCACGAAGTACAGGTGTCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACTTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MYEPDQVIIIILPFSQSPGVGATCFLLPYSSIKYHFFAHSPPTHIAWGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFTPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQVFAAKRHSHEETCHEVQVSPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

EMBL
AB046668    BAB21511.1    AB211537    BAE44464.1    NWSH01001820    PCG70022.1    + More
D38414    BAA07467.1    KZ149985    PZC75691.1    GFAH01000444    JAV47945.1    KK114278    KFM62077.1    IAAA01038678    LAA08500.1    GFTR01008639    JAW07787.1    KK121445    KFM80483.1    KP771712    AKU04650.1    GEGO01004274    JAR91130.1    KP771711    AKU04648.1    KK119855    KFM76920.1    KK115320    KFM64783.1    KK115566    KFM65430.1    AF015813    AAB94039.1    GEFM01006389    JAP69407.1    KU543676    AMS38357.1    GBBI01004920    JAC13792.1    GECZ01013919    JAS55850.1    GDAI01000743    JAI16860.1    KK116791    KFM68755.1    PABS01000003    MAT33547.1    GANO01003496    JAB56375.1    AF015489    AAB94030.1    GACK01003634    JAA61400.1    U73803    AAB92394.1    GFTR01008411    JAW08015.1    GECZ01017290    JAS52479.1    GFTR01006477    JAW09949.1    GEFM01005915    JAP69881.1    GANO01003141    JAB56730.1    GANO01003537    JAB56334.1    IACF01001650    LAB67339.1    MAYS01000558    OFC59623.1    MOOB01000219    OQE64972.1    X59239    CAA41925.1    GGLE01001887    MBY06013.1    GFTR01008541    JAW07885.1    GAPW01000103    JAC13495.1    KU543680    AMS38365.1    GDAI01000756    JAI16847.1    JATN01000322    EUC56479.1    JQGA01001155    KGO69287.1    GANO01003539    JAB56332.1    GANO01003538    JAB56333.1    IACF01002963    LAB68595.1    IACF01001499    LAB67197.1    U87543    AAB65093.1    GDAI01000752    JAI16851.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00075   RNase_H
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
PDB
2QKK     E-value=5.27567e-05,     Score=112

Ontologies

Topology

Length:
475
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
51.5254300000001
Exp number, first 60 AAs:
25.04222
Total prob of N-in:
0.94169
POSSIBLE N-term signal
sequence
inside
1  -  6
TMhelix
7  -  29
outside
30  -  475
 
 

Population Genetic Test Statistics

Pi
274.129387
Theta
168.677319
Tajima's D
1.954909
CLR
0.013218
CSRT
0.874556272186391
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号