SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01689
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.456
 

Sequence

CDS
ATGTCCGAGCTAGATATAAACTCTGAGAACTTATTTTCACCTCAGGTTAATTTACGTGAAATCGATTTAGATAATGCATACGATTTAGAGGCGAGCGGAGATGAGATTATCCATCCCCCAAAAAAACGAAAGCGTCTTTATATAAGAAGGGATTCAGAAACTAAATGTGATTTGGTGGAAAATGTTGTCACTGCAAATGTAGCTCATGTGTCTTCAAGTAGGCTACAAAAATGGAGAGAACCAACGGAACACCAACTATCGCAGATTGCATTCACGGAGCCAACGGGTATCAAGAAACCGTATGACGAAGAACTACGAAATGCAGATCCAGGGGCCTATTTCTCATTAATAGTCTCAGACGACATTTTTGAGGAAATCGCAGTGCAAACCAACTTGTATGCTGAGCGACGCGAGAGCACAATGCCTTCCTCGCGTTTGAATAGTTGGAAGCCAACAAACAAAAATGAAGTCAAGAGTCTTTTTGGACTTATTATGTACATGGGACTAGTCAAACTCCCAAAAATAAGTCTATACTGGAGCACAGACAGGGTTTTCAAACAAACTTTTGCGCCTTCGATTATGAGTCGAAATAGATTCGAACTGTTGTTGCAGAATCTGCATTTCGTTGAAAACGAAATAGCTGATGCCGCCGATAGAATCTATAAAATACGCAGTCTGATAGATAAGTTAAACAAATCATTTCAACGGTGCTATTCGCCCAAAGAAGAAGTTTGTGTCGACGAAAGTCAAGTCCCTTACAGCGGGCGATTGATCTTAAGGCAGGGCAATAAAAGAAAAAAGCATAAATGTGGAATGAAACTGGTCAAACTGTGCACAATACCAGGTTATACCTATAAATTAGAACTTTACGCTGGTAAAAACCACGAACCACTCAATACAACGCCTAAAAATGTTGTAATGTCAATCTGTAAAGAAATACTTGATTTGGGGCACACCGTAGCTACGAATAATTCGTACACAAGTTTGGATTTAGCCCACGAACTTCTAGACAGGAATACTCATTTATTAGGCACACTGAGAAAAAATAGTAAGGGCCTCCCGAAACAAGTAATTGATGCCAAACTTAAACAAGGCGAATCTGTGGAAATGGAAAACGAAAGAGGCATAACAGTGTTACACTGGAAAGATGAACGAAGTGTGTTAATGCTCTCCACAAAACACACTAAAGAATTTCCTAGTGTGCCCATAAAAGGAAAAATGGTTCGAACACCGAAATTGATTATAGCGTATAATAAAGCAAAAGGAGCTATTCACACGAGCGATCAAATGAACGCATACTCATCACCATTGAGAAAAACTCTAAAATGGTATAAAAAGTTAGGCATCGAATTAATTTTAAACACGGCCGTAGTCAACGCCTGGATCATGTTTTGCGAAAATACGGCTCAGCAAGGAATTGTAGAATTCCGACGTCAATTAGTGGAATATCTAGAATAA
Protein
MSELDINSENLFSPQVNLREIDLDNAYDLEASGDEIIHPPKKRKRLYIRRDSETKCDLVENVVTANVAHVSSSRLQKWREPTEHQLSQIAFTEPTGIKKPYDEELRNADPGAYFSLIVSDDIFEEIAVQTNLYAERRESTMPSSRLNSWKPTNKNEVKSLFGLIMYMGLVKLPKISLYWSTDRVFKQTFAPSIMSRNRFELLLQNLHFVENEIADAADRIYKIRSLIDKLNKSFQRCYSPKEEVCVDESQVPYSGRLILRQGNKRKKHKCGMKLVKLCTIPGYTYKLELYAGKNHEPLNTTPKNVVMSICKEILDLGHTVATNNSYTSLDLAHELLDRNTHLLGTLRKNSKGLPKQVIDAKLKQGESVEMENERGITVLHWKDERSVLMLSTKHTKEFPSVPIKGKMVRTPKLIIAYNKAKGAIHTSDQMNAYSSPLRKTLKWYKKLGIELILNTAVVNAWIMFCENTAQQGIVEFRRQLVEYLE

Summary

Similarity
Belongs to the universal ribosomal protein uS3 family.
EMBL
GAIX01005691    JAA86869.1    GBBI01004440    JAC14272.1    GBBI01004438    JAC14274.1    + More
GAIX01013935    JAA78625.1    GL453910    EFN75248.1    ATLV01021248    KE525315    KFB46173.1    GGMS01006604    MBY75807.1    GFXV01007414    MBW19219.1    ABLF02025866    ABLF02025869    ABLF02025877    ABLF02018838    JARK01001552    EYB90668.1    ABLF02029982    GAIX01004551    JAA88009.1    ABLF02011864    ABLF02011866    ABLF02042566    ABLF02010187    ABLF02050407    ABLF02012265    ABLF02038619    UYSL01019948    VDL71548.1    ABLF02030622    ABLF02030627    ABLF02011361    GECU01034165    JAS73541.1    JARK01001356    EYC20951.1    JARK01001390    EYC10641.1    ABLF02029983    GDRN01069744    JAI63996.1    JARK01001346    EYC26339.1    EYC26340.1    GAIX01003729    JAA88831.1    UYSL01024178    VDL83170.1    ABLF02011601    ABLF02011602    ABLF02016107    GDQN01006584    JAT84470.1    GBBI01004439    JAC14273.1    GDQN01011536    GDQN01001322    JAT79518.1    JAT89732.1    KE125300    EPB69401.1    ABLF02017387    KE647018    EQB62075.1    EYC26204.1    GDRN01075668    JAI63019.1    CAVP010055412    CDL94120.1    ACPB03026393    UZAF01018515    VDO52364.1    GECU01016947    JAS90759.1    UZAH01030493    VDP10747.1    GALX01005527    JAB62939.1    GDQN01004768    JAT86286.1    JARK01001477    EYB97365.1    UZAH01001106    VDO19503.1    JOJR01000056    RCN47811.1    LSMT01000021    PFX32631.1    KN716593    KJH43099.1    GGMS01012057    MBY81260.1    ABLF02028028    ABLF02006169    ABLF02055685    KK115799    KFM66072.1    GECU01002110    JAT05597.1    GEDC01003168    JAS34130.1    UZAF01017203    VDO39079.1    UXUI01007140    VDD85673.1    ODYU01000651    SOQ35792.1    AAGJ04151167    AB300558    BAF82021.1    BABH01021160    BABH01021161    BABH01021162    BABH01021163    GEBQ01012026    JAT27951.1    GEBQ01027849    JAT12128.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    GBHO01042743    GDHC01013469    JAG00861.1    JAQ05160.1    GEBQ01017560    JAT22417.1    BABH01041064    UZAH01030316    VDP10112.1    GECU01014964    JAS92742.1    AB300556    BAF82019.1    AB300557    BAF82020.1    GBHO01041038    JAG02566.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF05699   Dimer_Tnp_hAT
PF02037   SAP
PF05380   Peptidase_A17
PF00188   CAP
PF00189   Ribosomal_S3_C
PF07650   KH_2
PF13842   Tnp_zf-ribbon_2
PF05225   HTH_psq
Interpro
IPR029526   PGBD        + More
IPR008906   HATC_C_dom       
IPR012337   RNaseH-like_sf       
IPR003034   SAP_dom       
IPR036361   SAP_dom_sf       
IPR008042   Retrotrans_Pao       
IPR014044   CAP_domain       
IPR035940   CAP_sf       
IPR005703   Ribosomal_S3_euk/arc       
IPR036419   Ribosomal_S3_C_sf       
IPR001351   Ribosomal_S3_C       
IPR004044   KH_dom_type_2       
IPR018280   Ribosomal_S3_CS       
IPR015946   KH_dom-like_a/b       
IPR009019   KH_sf_prok-type       
IPR032718   PGBD4_C_Znf-ribbon       
IPR000315   Znf_B-box       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF68906   SSF68906       
SSF55797   SSF55797       
SSF54821   SSF54821       
SSF54814   SSF54814       
SSF46689   SSF46689       
SSF57667   SSF57667       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
485
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.00582
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03117
outside
1  -  485
 
 

Population Genetic Test Statistics

Pi
370.510352
Theta
235.012597
Tajima's D
1.978067
CLR
0
CSRT
0.879606019699015
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号