SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01680
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.282 Nuclear   Reliability : 1.105
 

Sequence

CDS
ATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTCGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTTAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTCGCTAGAGTTGGCGAGCGATTGAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTCTGCAGGTCTAGTCTCCCACCACTGCGCAAGTCCGATGACACTCTGGCCCACAGCGCGAAAGAAAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATTCCCCGGTGTGATAGCTCCCTGCCGGATATCTGCTTCACACAGTGTGCAGTCAGGCGGGAGCTCCGACTCCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTTTGAAAACGTGCGCCCCTGAGCTGACACCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACATGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATTATAAATACACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTCAAGCCTTGGAGAACAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGCATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGATAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACAAAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAAAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTATATGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGA
Protein
MSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRRDPNILGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDTLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCDSSLPDICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYMPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAQALENKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILHINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTKVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDASFGVIWKAKPSWRPKCWESSTKRSGTSRLDKDFICFIKHKSGLAWSTAPISGPGLPNTSFFHLTPYRGGPFGLSIIPFSRIVWSLWVCGGTSVPSVFCTVCSMGSALRNCSR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF04506   Rft-1
PF02460   Patched
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR007594   RFT1       
IPR030223   Dispatched       
IPR003392   Ptc/Disp       
IPR000731   SSD       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=8.89282e-06,     Score=120

Ontologies

Topology

Length:
640
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.81061
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00045
outside
1  -  640
 
 

Population Genetic Test Statistics

Pi
131.81626
Theta
19.055208
Tajima's D
3.211939
CLR
0.83663
CSRT
0.986900654967252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号