SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01653
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.858
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTAATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTGACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAGCATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTATATAGTGAGGAGATGCGATCAAGGCTGTTTGCTGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCACCGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGATGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCGCTGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAACCCGAGAAGTGTTTGCTGGAGGTTTAGGAACATGTAAATCACGCATAAAATTACATCTAAAAGAAAAGACGCCAATATTTGTAAAGGCGCGGGCGCTGCCACTGGCGTTGCGCGAGCGCGTTGAGCGAGAACTTGATCGTTTACAAAGTGAGGGAGTTATTTACAAAGTAGATAGGTCTGATTACGGCACGCCTATCGTACCAGTCGTTAAGGCAAATGGCGATATTCGTATTTGCGGCGACTATAAAATCACAATAAACCCACGTCTGAAGGATTATCACTATCCTTTGCCGCACATTAAAGATTTGTTTGCCACTTTAGGTGGTGGTGAATATTACACAAAATTGGATTTATCTAATGCATTCCAGCAATGCCTCTTAGACGAAGAATCCCAGCCGATGACAGCGATCACGACACACGTTGGTACTTTTGTCTACAAGCGCGTTCCGTTTGGAATTAAATGCATTCCGGAAAACTTTCAGAAGATTATGGAAGAGATTCTAAGTGTACTTTCTGTTGACAGCAGCCAGTACGGACTGGGCGCCGTCCTCACTCAGAAGCACATCGACGGCACTGAGCGGCTCGTCAGCTGTGCCTCACGGACTCTGGCGCCAGCCGAACTTAACTATTCTCAGCTGGACAAAGAAGCTTTGGCTATAATGTTTGGGGTTACTAAACACCATCAGTATTTGTACGGTAGACATTTTGTTTTACGAAGCGATCATAAGGCTCTGAGTTATATTCTTGGAAAGAATAAAGGTATACCTCTAACCGCCGCGAGTCGTCTGCAACGATTTGCTGTAAAGCTAGCTGCGTATGATTTTGAGGTCGAATTTATTAGTTCTACAGATAATTGCCAGGCTGACGCGCTATCACGACTTCCACTGGATACTAATTTTAAGAATAATATTAAGGAGTATAATTACCTAAACTTCGTTCAAGAAAGCTTTCCACTCAGTTTTAAAGAAATTAAAAAGGAAGTTACGAAGGATCCTTTACTAAACAAAATTTACGGTTACGTCATGTTTGGCTGGCCCTCTGTCAGTAAAGAACAAGCAGAAAAACCCTATTTTAACAGAAGAGAATCCATACATATTGATCACGGTTGTCTTCTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGTCGGAACTATGTATGGTGGGAGACAGTCGATGCGGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGGTCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCATGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTTAATAACAAATATTACTTAATTATAGTTGACGCTCATTCAAAATGGATTGAGGTGGAAAAATTGAGCGGTACATCAGCCACGGCAGTAATCGCTTGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAGGGTAGTAACTGATAACGGACCACCTTTCTCGTCGGTCGAATTTAGATCATATTTAAGTAAAAACGGTATAAAACATTTAGCGGTGGCTCCGTATCATCCATCTAGCAATGGTGCAGCGGAAAACGCCGTAAAAACCATAAAAAGGGTGTTGAAAAAGGCTCTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGTACAGAAATTCTGAGCATAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCCAATACCAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCTGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCACAGGAACAATAAAAAATCGATCAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAGATTTTAATAAGTAATAATAGTCGAAAATCACGTTATTCTTTGTCAAAATTAAACACTGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGTTCGGGAAAGTCCGTGTATGACCGGAGAAAAGGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTTCTAGGCACTCGCCGGCGCCGAATGTCTTGCAACCATCGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFNMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNESIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGLYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGTGGSSQAASESDGMHRVGGARAEARCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKTREVFAGGLGTCKSRIKLHLKEKTPIFVKARALPLALRERVERELDRLQSEGVIYKVDRSDYGTPIVPVVKANGDIRICGDYKITINPRLKDYHYPLPHIKDLFATLGGGEYYTKLDLSNAFQQCLLDEESQPMTAITTHVGTFVYKRVPFGIKCIPENFQKIMEEILSVLSVDSSQYGLGAVLTQKHIDGTERLVSCASRTLAPAELNYSQLDKEALAIMFGVTKHHQYLYGRHFVLRSDHKALSYILGKNKGIPLTAASRLQRFAVKLAAYDFEVEFISSTDNCQADALSRLPLDTNFKNNIKEYNYLNFVQESFPLSFKEIKKEVTKDPLLNKIYGYVMFGWPSVSKEQAEKPYFNRRESIHIDHGCLLWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSGTSATAVIACLRRLFARFGLAKRVVTDNGPPFSSVEFRSYLSKNGIKHLAVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMYRNSEHSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTTGTIKNRSGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNTDFETKSVNDSVGEVRESPCMTGEKELNSSYDTGPESPQPVTSRHSPAPNVLQPSRQRRKAALTCIQRIKDQNY

Summary

Uniprot
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF00078   RVT_1
Interpro
IPR001995   Peptidase_A2_cat        + More
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
4OL8     E-value=3.23272e-12,     Score=177

Ontologies

Topology

Length:
1018
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00112
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.00002
outside
1  -  1018
 
 

Population Genetic Test Statistics

Pi
418.220453
Theta
209.850443
Tajima's D
3.4369
CLR
0.348503
CSRT
0.993250337483126
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号